1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arlecino [84]
3 years ago
14

In glycolysis, the carbon-containing compound that functions as the electron donor is ____________

Biology
1 answer:
tia_tia [17]3 years ago
6 0

Answer: glucose

Explanation:

You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
What was likely the purpose of the Great Enclosure?
xz_007 [3.2K]

Answer:

<em>B. </em>

Explanation:

(^-^)

6 0
1 year ago
A rock formed from the remains of living organisms. the rock is pale in color and soft. the rock is probably a
mario62 [17]
Sedimentary rock is the answer
7 0
3 years ago
In the polymerization of DNA, a phosphodiester bond is formed between a phosphate group of the nucleotide being added and which
valina [46]

Answer: B

Explanation:

During polymerization of nucleotides to form nucleic acids, the hydroxyl group on the phosphate group attaches to the 3’ carbon of a sugar of one nucleotide to form an ester bond to the phosphate of another nucleotide. The reaction forms a phosphodiester linkage and eliminates a water molecule.

The DNA strands generally runs from 5 prime to 3 prime direction.

4 0
3 years ago
HURRY 100 points and a brainlest
In-s [12.5K]

Answer:

The direct threats of invasive species include preying on native species, outcompeting native species for food or other resources, causing or carrying disease, and preventing native species from reproducing or killing a native species' young.

Explanation:

3 0
2 years ago
Other questions:
  • Why do the gas giants have many moons?​
    14·1 answer
  • What are three nucleotides together called on mRNA?
    8·1 answer
  • When the mineral-rich water from a hydrothermal vent hits the surrounding sea-water, the minerals rushing out give the water the
    14·2 answers
  • Why are humans not able to digest cellulose?
    13·1 answer
  • Suppose chromosomes in a skin cell are damaged by ultraviolet radiation. if the damaged genes do not effect cell cycle regulatio
    12·2 answers
  • Menstrual cramps are experienced with the onset of the menses because of strong contractions of the ____ layer of the uterus.​
    9·1 answer
  • In which layer is the temperature the highest?
    6·2 answers
  • In mitosis, each chromosome is made up of __________ that carry the same alleles.
    12·1 answer
  • What is an analogous structure
    9·1 answer
  • A male and female Oompah have the same genotypes: blue face (ff) and big feet (Ll). Determine what they’re offspring may look li
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!