1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KatRina [158]
3 years ago
13

Explain the effects of unregulated (or abnormal) cellular processes on the body

Biology
1 answer:
sasho [114]3 years ago
6 0
<span>If cells are unregulated they can over proliferate and cause things like cancer. Abnormal cellular growth causes tumors and improper resource distribution. Unregulated cellular processes use up nutrition not readily available and can cause harm to cells around the tumor.</span>
You might be interested in
Which ingredients in MacConkey agar supplies Nitrogen?
kifflom [539]
The ingredients in MacConkey agar supplies that supplies nitrogen are enzymatic digest of Gelatin, Casein and Animal tissue.
8 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
What is the outermost structure that surrounds and supports plant and fungal cells?]
Butoxors [25]
Cell wall I hope it is
6 0
3 years ago
Read 2 more answers
What are some ways cells help an organism?
Burka [1]
Some blood cells responsible for the transportation of oxygen and other are there for rebuilding of tissues. Fights things the body doesn't recognize
5 0
3 years ago
What is the name of the cells that control the opening and closing of the stomota
Butoxors [25]

Answer:

guard cells

Explanation:

they control the opening and closing of the stomata

4 0
2 years ago
Other questions:
  • All of the following are functi?
    7·2 answers
  • The visible surface of uranus and neptune are bluish-green because they consist of:
    14·1 answer
  • A student set up four test tubes containing starch solution in which to perform starch digestion. Supplies included amylase (enz
    15·1 answer
  • In determining whether a particular act occurred within the scope of employment, courts will evaluate whether the employee’s act
    9·2 answers
  • Which process releases energy instead of using energy?
    9·2 answers
  • Which two codons in the mRNA represent the amino acid phenylalanine
    10·1 answer
  • In a predator prey graph, the peak for the predator population always comes after the peak for the prey
    9·1 answer
  • Please tell me as much as you can about non-disjunction and the consequences of non-disjunction at meiosis 1 versus meiosis 2
    7·1 answer
  • What is a transgenic organism
    10·1 answer
  • What relationships exists between frogs and fishes in a pod
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!