1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GarryVolchara [31]
3 years ago
13

How does the brain develop during adolescence?

Biology
1 answer:
mario62 [17]3 years ago
3 0

Because the prefrontal cortex is still developing, teenagers might rely on a part of the brain called the amygdala to make decisions and solve problems more than adults do. The amygdala is associated with emotions, impulses, aggression and instinctive behaviour.

You might be interested in
Help me ans this question please.
Umnica [9.8K]
It’s a study of unusual behaviors,emotion,and thought hope this helped
3 0
3 years ago
Jellyfish Process of Asexual Reproduction in a brief​ description?
prisoha [69]
If you go to this link, you will be able to see the answer: http://prezi.com/eatd8nhptvh1/?utm_campaign=share&utm_medium=copy&rc=ex0share
3 0
3 years ago
True or false: the average virus is quite large when compared with cells true or false
pashok25 [27]

Answer:

The answer is false viruses are 1/10th the size of cells

Explanation:

6 0
3 years ago
Read 2 more answers
PSYCHOLOGY!!! 20 points! Match the following vocabulary works with their definitions.
kati45 [8]

Answer:

1 mental pictures that have no direct

relationship to the actual object you are

thinking about

2 to gain or obtain for yourself

3 a ranking system

4 perceptually distinct units of sound in a specified language that distinguish one word from another

5 to figure out or unscramble hidden

meaning

6 the aspects of a dream or fantasy

that you remember

Explanation:

#4 I don't see the match in what you posted but the definition of phoneme is what I wrote.

7 0
3 years ago
Read 2 more answers
___________ is a drug that is regularly used in veterinary medicine.
Blababa [14]
Ketamine is the drug regularly used in <span>veterinary medicine. </span>
7 0
3 years ago
Other questions:
  • Marge suffered a stroke in the underside of the right temporal lobe. Which brain function is likely to be affected?
    8·1 answer
  • Cell theory states that all living things contain one or more cells. Why do you think cell theory meets the definition of a scie
    6·2 answers
  • True or False: Florida manatees are doing well throughout their range.
    8·1 answer
  • The process that reduces the number of chromosomes in half is called;
    14·1 answer
  • Which describes the effects of population increase and resource depletion
    8·2 answers
  • A book that weighs 20 N sits on a table. How big and in what direction does the force of gravity from the Earth act on the book?
    9·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Just do the first one and if you don’t know it don’t answer please this is due today
    15·1 answer
  • For IPC.
    13·1 answer
  • DNA makes us all unique by controlling the production of _______that make us look different and have the structures to better su
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!