1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mnenie [13.5K]
2 years ago
15

What is considered an abiotic factor in a marine ecosystem?

Biology
1 answer:
serious [3.7K]2 years ago
3 0
An abiotic factor is not living. ex./ sand
You might be interested in
Which of the following best summarizes how hormone levels are controlled?
zavuch27 [327]
Insulin causes blood glucose levels<span> to drop, which signals the pancreas to stop producing insulin in a negative feedback loop.</span>Hormonal<span> stimuli refer to the release of a </span>hormone<span> in response to another </span>hormone. ... The anterior pituitary in turn releaseshormones<span> that regulate </span>hormone<span> production by other endocrine glands.

</span>
7 0
3 years ago
Which best explains why angiosperms are the most diverse and successful plant group today?
Arturiano [62]

Angiosperms are the most diverse and successful plant group. It has double fertilization which leads to the formation of an endosperm. It also has a stamen with two pollen sacs. It has a phloem tissue that is composed of sieve tubes and companion cells.

5 0
3 years ago
Read 2 more answers
The Persians began a system of managing government that is called a _____
g100num [7]

Answer:

The Persians began a system of managing government that is called a <u>absolute monarchy </u>

Explanation:

The had a absolute monarchy government with a decentralized administration and  local autonomy

5 0
3 years ago
What plate tectonic features are most likely to occur when earths plates move away from each other
almond37 [142]
Sink holes and crevasses might be a result of this <span />
4 0
3 years ago
Water stores heat much longer than other substances do allowing organisms to
Wittaler [7]
Because water is so good at storing heat energy, it is harder for organisms to experience a change in body temperature in harsher climates.
3 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What is an animal that is classified as an invertebrate?
    6·2 answers
  • Termos e fatores ecossistema e comunidade são sinônimo
    14·1 answer
  • Imagine that a researcher discovers two new similar species of bats in the same geographic area. Amazingly, one of these species
    5·1 answer
  • Water is often called "universal solvent" because may substances can be dissolved in water. What property of water allows it to
    8·1 answer
  • 3. The nitrogenous base, adenine, pairs with
    9·1 answer
  • Describe one way that a decrease in species diversity can affect an ecosystem
    12·1 answer
  • I NEED HELP ASAP
    9·2 answers
  • Geologists of the time were doing research that said
    13·1 answer
  • What is the total magnification with each objective?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!