1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fudgin [204]
4 years ago
12

Which of the following form conidiospores? A) Endospore-forming gram-positive rods and cocci B) Actinomycetes and related organi

sms C) Rickettsias D) Anaerobic gram-negative cocci E) Spiral and curved bacteria
Biology
2 answers:
alexandr402 [8]4 years ago
6 0

B) Actinomycetes and related organisms

Hatshy [7]4 years ago
6 0
B))) is you answer good luck
You might be interested in
Which of the following actions would you take to remain safe in the lab?
LekaFEV [45]

Answer: While cutting a screen for an aquarium top, you point the scissors away from your body.

You pipette a liquid using a bulb pipette.

You heat a liquid by placing it in a plastic beaker on a hot plate.

Explanation:

5 0
4 years ago
What keeps the cell membrane from collapsing
maw [93]
According to science writer Clare Smith for SeattlePi, the cell membrane<span> is kept from</span>collapsing<span> by its phospholipid bilayer, maintenance of the correct temperature, a cytoskeleton and </span>cell<span> junctions. These are necessary because the </span>cell membrane<span> is one of the most crucial components of a </span>cell<span>. Hope it helped!</span>
4 0
3 years ago
Consider the mammalian heart. why is the muscular wall of the left ventricle thicker than that of the right ventricle? the left
Julli [10]
The left ventricle must contract with more force in order to send blood to the body's extremities

I hope this helps! I'm happy to answer any other questions you might have :)

8 0
3 years ago
Mating is rarely random. Many organisms choose a mate for specific reasons - body size, coloration, antler size, feather length,
poizon [28]

Answer:

Natural selection

Explanation:

Sexual selection refers to the natural selection where the allele frequencies of a population are changed due to nonrandom mating between the individuals. Certain preferences for the mate by organisms result in sexual selection. It is mostly exhibited by females.

For example, peahen prefers the peacocks with elaborate tail features as their mate. The sexual selection also occurs when there is competition among the members of the same sex for a mate. This type of sexual selection is mostly exhibited by males and results in fighting and display.

3 0
3 years ago
1. which pairing matches the structures shown in the cell diagrams with th
Mademuasel [1]

Explanation:

D. E: photosynthesis; D: cellular respiration

Photosynthesis is a chemical pathway that’s integral to producing energy in plants and other primary producers. Energy in the form of molecules of glucose is produced from light, water and carbon dioxide while oxygen is released. This occurs in several complex steps, photosynthesis is a rate limited reaction, depends on several factors including carbon dioxide concentration, ambient temperature and light intensity; the energy is retrieved from photons, I.e. particles of light, and water is used as a reducing agent.

In the light reactions, occuring within the thykaloid, and stroma of the chloroplasts, water supplies the pigment chlorophyll with replacement electrons for the ones removed from photosystem II. Additionally, water (H2O) split by light during photolysis into H+ and OH- acts as a source of oxygen along with functioning as a reducing agent; it reduces the molecule NADP to NADPH by providing H+ ions. NADP and NADPH are integral to the dark reactions, or Calvin cycle where monosaccharides or sugars like glucose are produced after the modification of several molecules.

Respiration in the mitochondria utilizes oxygen for the production of ATP in the Krebs’s cycle via the oxidization of pyruvate (through the process of glycoysis). The electron transport chain, in which oxygen functions as the terminal electron acceptor, occurs in both plants and animals. Respiration includes:

  • Glycolysis: occurs in the cytoplasm 2 molecules of ATP are used to cleave glucose into 2 pyruvates, 4 ATP and 2 electron carrying NADH molecules.
  • The Kreb's cycle: in the mitochondrial matrix- 6 molecules of CO2 are produced by combining oxygen and the carbon within pyruvate, 2 ATP oxygen molecules, 8 NADH and 2 FADH2.
  • The electron transport chain, ETC: in the inner mitochondrial membrane, 34 ATP, electrons combine with H+ split from 10 NADH, 4 FADH2, renewing the number of electron acceptors and 3 oxygen; this forms 6 H2O, 10 NAD+, 4 FAD.

Learn more about cellular respiration at brainly.com/question/11203046

Learn more about Photosynthesis at brainly.com/question/4216541

Learn more about cellular life at brainly.com/question/11259903

#LearnWithBrainly

6 0
3 years ago
Other questions:
  • How would earths atmosphere be different if organisms capable of photosynthesis has not evolved?
    14·1 answer
  • In this mechanism, the enzyme “dicer” cuts dsRNA into smaller fragments called ,
    12·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A peptide linkage forms between
    6·1 answer
  • Where does glycolysis take place?<br><br><br> A. in the cytoplasm<br><br> B. in the cell nucleuS
    5·1 answer
  • Which describes the solid flying debris from a volcano?
    10·2 answers
  • What is the most effective approach the government can take to keep the air cleaner
    13·1 answer
  • How does the insertion mutation affect the DNA?
    5·1 answer
  • To determine the volume of a wooden cube you would use wate<br> displacement.<br> true or false?
    15·1 answer
  • True or false? A person suffering from HIV/AIDS is more likely to become infected with tuberculosis.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!