I hope this can help some.
The induced-fit model includes the change in the conformational site of the substrate and enzyme. It is done till the enzyme completely binds the substrate. This will then activates the enzyme to perform its work.
<h3>What is induced fit theory?</h3>
Induced fit theory or model suggest that the activation site of enzymes and the binding site of substrates undergo some conformational changes to fit into each other.
This binding results in activation of the enzyme and as the enzyme has a three-dimensional tertiary structure, this would help it to get fitted into the substrate.
Thus, with reference to the induced fit model tertiary structure of enzyme facilitates its function as a biological catalyst.
For more details regarding induced fit theory, visit:
brainly.com/question/3042463
#SPJ4
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
is there a multiple choice?? or anything
Answer:
The expression of the mRNA decreases.
Explanation:
The RNAi binds to some proteins forming a silencing complex. This complex binds to the target mRNA (of which the RNAi is complementary) and cleaves it (cuts it). The cell will detect the generated fragments of mRNA , recognize they are aberrant and will thus degrade them.
All in all, this mechanism silences (reduces) the expression of the mRNA, because it will be degraded instead of translated into protein.