1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gala2k [10]
4 years ago
15

Phosphates in a sentence

Biology
1 answer:
olasank [31]4 years ago
6 0
On the decay of these structures the phosphates<span> are returned to the inorganic world, thus completing the cycle.</span><span>

</span>Of mineral constituents, whether used alone or in mixture with nitrogenous manures, phosphates<span> are much more effective than mixtures of salts of potash, soda and magnesia.</span>

Many of the above include descriptions of mineral phosphates<span> in other parts of the world.</span><span>
</span>

You might be interested in
This is due in and 1hr and 15mins can someone plz help me!!:
Bumek [7]

Answer:

Sea turtle

a. species of animal: Chelonioidea

b. location of animal (state or country): FLORIDA: Here are some places to see the magical nesting sea turtles in Florida:

Von D. Mizell-Eula Johnson State Park.

Sebastian Inlet State Park Fishing Museum.

Barrier Island Sanctuary.

Sea Turtle Preservation Society.

John D. MacArthur Beach State Park.

c. the animal's status (extinct, endangered, threatened, etc.): ENDANGERED

d. reason for status (why is animal extinct, endangered, threatened, etc.)

Slaughtered for their eggs, meat, skin, and shells, sea turtles suffer from poaching and over-exploitation. They also face habitat destruction and accidental capture—known as bycatch—in fishing gear.  

e. type of habitat needed for survival:

Adults of most species are found in shallow, coastal waters, bays, lagoons, and estuaries. Some also venture into the open sea. Juveniles of some species may be found in bays and estuaries, as well as at sea.

f. conservation efforts on the animal's behalf:

Reduce marine debris that may entangle or be accidentally eaten by sea turtles.

Participate in coastal clean-ups and reduce plastic use to keep our beaches and ocean clean. ...

Carry reusable water bottles and shopping bags. ...

Keep nesting beaches dark and safe for sea turtles.

g. prospects for the future of this animal

It is projected to submerge about 80 percent of current habitat that is predicted to have a suitable climate for future egg incubation. But sea-level rise is also projected to create new beaches.

Recent research suggests there is hope for beleaguered sea turtles. Important recovery in some local populations has shown that we can turn things around for sea turtles, especially with effective endangered species policy and improved management

4 0
3 years ago
Which nutrient is found in meat, fish and pulses? When digested it forms amino acids
Sliva [168]
Your answer would be protein :)
5 0
3 years ago
Read 2 more answers
When testing to determine the presence of lipids in food, which solution or reagent should be used?
ArbitrLikvidat [17]
The answer should be C, Sudan red solution.

Sudan red solution dissolves in lipids, which can show a color of orange/red if lipid is present.

On the other hand, Biuret solution/reagent is used to test for proteins, and it'll show a color or purple if protein is present.

Iodine solution is used to test for the presence of starch, and it'll show a blue black color if starch is present.

And lastly, Benedict's solution is used to test for reducing sugars, and it'll show a brick red color (or green as small amounts) if reducing sugars are present after heating under boiling water bath.
3 0
4 years ago
Why do you think molds are not growing all over everything around you?
Olegator [25]

Because:

Not everything around you has the correct moisture to grow mold. Places like a shower, wood, and even toilets do, since water will soak into them, or the water is trapped. If you don't clean your shower and toilet, you will notice mold. If you look at a fence, there is probably hints of mold on it.

Something like a shelf cannot grow mold, since it usually has paint on it, and the moisture won't go through something like paint.

Another possible answer: Since the areas around you don't always have the correct moisture, mold will not grow on everything. It can grow on some stuff in your house, but not everything around you.


If you need any more help, let me know !

7 0
3 years ago
Is Himalayan mountain still forming today? Explain please:/
Dmitriy789 [7]
Yes, the Indian tectonic plate is moving north and the Eurasian tectonic plate is moving south causing the 2 plates to collide. This collision of plates causes the crust of the earth to crumple upwards resulting in a mountain range.<span />
3 0
4 years ago
Other questions:
  • What is the primary energy system to fuel cycling at 70% of VO2 Max for 15 minuets?
    8·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • Igneous rock texture refers to ____ size
    15·2 answers
  • How and why do people remove nitrogen from the Earth’s crust?
    14·1 answer
  • I need help with this problem
    7·1 answer
  • PLEASE HELP!!Need to submit these assignments before tomorrow for extra credit.
    13·1 answer
  • What is one way in which energy flow differs from chemical cycling?
    6·1 answer
  • Which organism actively hunts other
    11·2 answers
  • A species that has experienced a severe bottleneck event would be expected to __________.
    8·1 answer
  • Which of the following muscles does NOT originate on the scapula?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!