Answer:
Explanation
the two basic difference between RNA and DNA are
RNA is single stranded while DNA is double stranded
RNA contain uracil and DNA contain thymine
Answer:
Cells make RNA messages in a process similar to the replication of DNA. The DNA strands are pulled apart in the location of the gene to be transcribed, and enzymes create the messenger RNA from the sequence of DNA bases using the base pairing rules
Explanation:
Answer:
Skeletal muscles fibre are classified base on how the produce energy.
Explanation:
Skeletal muscles fibres consist of bundles of cells that form muscles which contain myobrills.
Skeletal muscles are classified based on how the produce energy;
Type 1 or slow pitch muscle fibres are more efficient and last for a long period of time. They are use for postural maintenance or endurance. It use aerobic respiration to produce energy or ATP.
Type 11 or fast twitch muscle fibres use anaerobic respiration and are for short speed and fatigue more easily than type 1.
Answer:
chemical change.
Explanation:
There are two types of changes in matter: physical change and chemical change.
physical change- it is a change in matter that alters only its physical properties or its physical appearance. This type of change is reversible. For example- freezing of water, the water turns into solid ice and it can be reversed by melting the ice.
chemical change- it is a change in matter that alter its chemical and thus its physical properties. Most chemical changes are irreversible. for example- burning of paper, results in black soot and ashes- Thus changing both physical and chemical properties.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
