1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex17521 [72]
3 years ago
11

How can carbon dioxide be considered a pollutant when it is a natural component of air?

Biology
2 answers:
evablogger [386]3 years ago
5 0
It is indeed answer choice B :)
Oduvanchick [21]3 years ago
4 0

The correct answer is option B

Carbon dioxide is present in the environment along with the other gases and still it is considered as a pollutant when its concentration in the atmosphere increases than the normal concentrations.

The normal concentration of the carbon dioxide is maintained by the help of plants that use carbon dioxide for the process of photosynthesis.

The increased amount of carbon dioxide in the atmosphere is caused due to the human activity.

Industrial release, pollution from automobiles are some of the sources of carbon dioxide emission.

You might be interested in
What factors can affect neurotransmission?
Juliette [100K]
<span>Factors that affect 'neurotransmission' are plentiful, but the most common include genetics, eating habits, exposure to chemicals, and in the case of humans, stress.</span><span>
</span>
5 0
3 years ago
explain why eating down a food chain," vegetables instead of meat for example, is more energy efficient
Brut [27]

Answer:

I would say that meat is more energy efficient than vegetables because meat have more calories than vegetables do. Calories equal energy. For example, vegetables have an average calorie of 10 - 90 calories. While meat has 100 - 1200 calories. So, if calorie equals energy, I would say that calories are the reason why meat has more energy in it.

Explanation:

Mark as brainliest PLZ! It will make my day! Thank you!

Visit my church's website at fbcinterlaken.org if you want to learn more about God!

4 0
3 years ago
Which biomolecules are found in all organisms?
blagie [28]

Answer:

I don't know I may be wrong but I think its the last option.

Explanation:

8 0
3 years ago
Can anyone tell me the Plant taxonomy Of any 10 flowers with 1 line explanation of each one
olga2289 [7]

Plant taxonomy is the classification of a plant based on different levels (taxa) such as kingdom, division (phylum), class, order, family, genus, species.

<h3>What is taxonomy of ten flowers?</h3>

The taxonomy of few flowers is as follows:

  • For Rose flower ; Kingdom : Plantae, Division: Magnoliophyta, Class: Magnoliopsida, Order: Rosales, Family: Rosacea, Subfamily: Rosoideae, and Genus: Rosa, Species: Rosa gallica and Rosa canina.

  • For hibiscus flower: Kingdom: plantae, class: Magnoliopsida, Order: Malvales, Family: Malvaceae, Genus: Hibiscus L.

  • For Buttercup ; Kingdom: Plantae ; Division: Magnoliophyta ; Class: Magnoliopsida ; Order: Ranunculales ; Family: Ranunculaceae,Genus: Ranunculus.

  • For California Poppy: Kingdom: Plantae · Phylum: Spermatophyta · Subphylum: Angiospermae · Class: Dicotyledonae · Order: Papaverales, Family:Papaveraceae.

  • For Daffodil: Domain: Eukaryota · Kingdom: Plantae · Phylum: Spermatophyta · Subphylum: Angiospermae · Class: Monocotyledonae.

  • For sunflower: Kingdom; plante, Division;tracheophytes,Class;Magnoliopsida,Order; Asterales, Family:Asteraceae, Genus: Bellis L. – bellis, Species: Bellis perennis L.

  • For tulip: Kingdom; Plantae, Phylum;Spermatophyta, Subphylum;Angiospermae, Class;Monocotyledonae, Phylum:Spermatophyta, Domain: Eukaryota.

  • For balsam: Kingdom; Plantae, Division; Tracheophyta, Class; Pinopsida conifers,Order; Pinales pines, Family; Pinaceae pines, Genus Abies M., Species: Abies balsamea (L.).

Therefore, Plant taxonomy is the classification of a plant based on different levels (taxa) such as kingdom, division (phylum), class, order, family, genus, species.

Learn more about taxonomy here:

brainly.com/question/1304906

#SPJ1

8 0
2 years ago
What type of circulatory stay do humans have
Olin [163]

Answer:

While humans, as well as other vertebrates, have a closed blood circulatory system (meaning that the blood never leaves the network of arteries, veins and capillaries), some invertebrate groups have an open circulatory system containing a heart but limited blood vessels.

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Because b vitamins are ___________________, very little is stored and excess ends up in the urine or sto
    5·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • What is the pectoral fin in tilapia fish used for​
    10·1 answer
  • How to isolate Saccharomyces cerevisiae (Baker’s yeast)?
    9·1 answer
  • The hardness of a steel nail is about 5.5 a certain mineral scratches a steel nail but does not scratch quartz. What could the h
    13·2 answers
  • The cerebrum, cerebral hemisphere and cerebellum are structures found in the?
    7·1 answer
  • Which impact of global warming has the greatest effect on drinking water supplies?
    6·2 answers
  • HI
    11·2 answers
  • Which of the following statements is FALSE concerning the right atrium? a. It receives blood from the inferior and superior vena
    8·1 answer
  • PLEASE HELPPPP I don’t understand this one
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!