1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LenaWriter [7]
2 years ago
13

The beaks of the different finches on the Galapagos island differed based on what?

Biology
1 answer:
Charra [1.4K]2 years ago
4 0

 The beaks are different  depending on the food available on the island.

You might be interested in
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Aging skin becomes less resistant to infection and other diseases because the number of _____ decrease and are less efficient.
Arte-miy333 [17]
Cells !!!!!!!!!!!!!!!!!!
5 0
2 years ago
Read 2 more answers
When you decrease the pH in the simulation, the ocean’s acidity increases. What do you expect to happen over time to the populat
kherson [118]

Answer:

With decrease in pH of ocean water, the survival rate of corals, algae, and fish in coral reef reduces.

Explanation:

Coral reefs find difficulty in living in acidic ocean water. It is so because the coral’s shell that is made up of calcium carbonate is unable to sustain in acidic environment.  

Not only this the skeleton of snails, clams, algae , fish etc is also made up of calcium carbonate. Increased acidity leads to death of these species.  

Thus, the lower is the pH of ocean water, the higher is its acidity and hence the lower is the probability of survival of corals, algae, and fish in the coral reef

8 0
3 years ago
ADP is used as an energy source in organisms. True or False​
Novosadov [1.4K]
ATP is the most common energy source used in metabolism, so false I would say.
5 0
3 years ago
Please help me please will give brainliest <br><br>​
Darya [45]

Answer:

Question 1: genetic material is found in protein

Question 2: messenger RNA

7 0
3 years ago
Other questions:
  • How were Lamarck’s and Darwin’s ideas most similar? Both stated that humans should be studied as individuals. Both stated that n
    11·2 answers
  • most common reason for decompensation of previously well-compensated heart failure during dental treatment?
    11·2 answers
  • 2. Copy/paste and align the first 5 bases of all introns. Which bases are conserved near intron start ("donor site")?
    7·1 answer
  • Which structure in the leaf controls the opening and closing of the stoma?
    10·1 answer
  • The rate of a reaction catalyzed by an enzymes usually ________ with temperature; however, at temperatures above the optimum ran
    9·1 answer
  • The main job of the small intestine is to
    12·2 answers
  • What is the cell Body​
    15·2 answers
  • What is unique about the life cycle of angiosperm ?
    9·1 answer
  • Chondrocytes are found in cavities called
    10·1 answer
  • Explain why eggs and sperm only have half the amount of DNA as a normal body cell.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!