1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sertanlavr [38]
3 years ago
10

What are three types of tissue that make up the heart

Biology
1 answer:
sp2606 [1]3 years ago
5 0
Skeletal, smooth, and carbiac. Carbiac makes up the heart.
You might be interested in
What is a fossil and give example
aniked [119]
The remains of a Hadrosaur are an example of a fossil typically structures like bones shells and teeth fossilized more often then things like tissues or plant leaves.
3 0
3 years ago
Why do you need to evaluate claims made on product labels?
Morgarella [4.7K]
Because you wouldn’t want to harm others and they would want to know what there putting
5 0
3 years ago
An allergic reaction that is characterized by the eruption of pale red elevated patches is _____
Fed [463]
The answer is urticaria (also known as hives).
3 0
3 years ago
Read 2 more answers
Question is in picture
mojhsa [17]

Answer:

  • it can show a population pyramid  
  • They also show the number of dependents (children and, sometimes, elderly people) and general structure of the population at any given moment.
  • it compares and contrast  the age of th female and male where it typically forms the shape of a pyramid when the population is growing which can give you a  general idea on both genders
  • it can help see who (female or male) are the most type in that area

Credit:

  • brainly.com/question/23995769

4 0
2 years ago
A light microscope that makes the specimen appear light on a dark background is called a(n) _____. compound microscope electron
AnnZ [28]

The right option is; dark-field microscope

A light microscope that makes the specimen appear light on a dark background is called a dark field microscope.

Dark field microscopes are light microscopes that are used in different ways to clearly view various specimens that are unstained, transparent, and hard to see using a light field unit. Dark field microscopes are very effective because they show the details of unstained and live samples. It is also very simple to use, and inexpensive to set up.


7 0
3 years ago
Read 2 more answers
Other questions:
  • The pituitary gland is divided into _______ lobes.
    13·2 answers
  • Refer to the illustration above. The cell shown is probably an animal cell because it *
    15·1 answer
  • Name the three types of pathogen and an example of a disease they cause
    9·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What is the spinal cord made up of?
    7·2 answers
  • How do you tell if the pedigree is recissive ordominant? By the wa the cirlces and squares with all da lines andscribbles are sh
    12·1 answer
  • A biologist discovers two populations of wolf spiders whose members appear identical. Members of one
    7·1 answer
  • 1. Who was the best known for making the thought of evolution acceptable for
    13·1 answer
  • What is the total amount of protein, in grams, Morgan will get after 7 weeks of eating the same food items for breakfast and lun
    15·2 answers
  • what is the most common type of laboratory assay that is widely used to assess thyroid hormone concentration
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!