1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
melamori03 [73]
3 years ago
6

Which best describes plant classification?

Biology
1 answer:
Delvig [45]3 years ago
5 0

Answer:

Angiosperms are grouped into monocots and dicots.

Explanation:

Angiosperms, commonly known as Flowering plants, are the most diverse and advanced group of plants in the Kingdom Plantae. Angiosperms are characterized by their ability to produce reproductive structures called FLOWERS, which becomes seeds borne in fruits when fertilized. Hence, they are regarded as seed plants.

Angiospermic plants are classified as either monocotyledonous i.e. plants that contain one seed-leaf or dicotyledonous i.e. plants that contain two seed-leaves. Hence, based on the provided options, Angiosperms are grouped into monocots and dicots is the most appropriate plant classification.

You might be interested in
The ability of trees to transport water hundreds of feet up from the roots is at least partially due to...
spin [16.1K]

Answer:

option B. cohesion..........tree.

4 0
3 years ago
A gardener accidentally trims the leaves of a green plant too short. The
shutvik [7]
The leaves are smaller, meaning the plant cannot photosynthesize as fast as before. This means that the plant cannot produce as much energy and grows slower as a result.
8 0
3 years ago
Read 2 more answers
Explain in your own words the process using the following key words: carbon-di-oxide, water, sugar, oxygen, thylakoid, chloropla
solniwko [45]

Answer:

All the above keywords conclude a process used by plant which is known as photosynthesis. This process is done by all the green plants in the presence of sunlight and also in dark.

Explanation:

Photosynthesis is defined as the process by which all the green plants prepare their food in the presence of sunlight by the use of water, minerals and carbon dioxide. Chloroplast provides green color to the plant and it is also known as photosynthesis site. Glucose is the product and oxygen is a byproduct of photosynthesis.

Calvin cycle is a type of photosynthesis that is also followed by some. the energy released is counted in the terms of ATP which is also known as adenosine triphosphate. Sunlight plays a role of catalyst in the formation of food by the process of photosynthesis

8 0
3 years ago
Fill in the blank.
Inessa [10]
The answer tot his question is:

<span>Fill in the blank. 
</span>A scientific ___________ is a proposed explanation that can be tested."<span>Scientific Theory."

Hoped This helped, </span><span> Jaylamariejohsov5zsb
Your Welcome:) </span>
8 0
3 years ago
Read 2 more answers
Which properties are used to identify minerals? Select three options
Vinil7 [7]
Some of the physical properties of mineral are color, density, crystalline structure luster, odor and magnetism
4 0
3 years ago
Other questions:
  • Health-insurance companies could potentially use genetic information for client discrimination if it were made publically availa
    9·2 answers
  • A print fossil of a vertebrate is very rare.<br><br> True or False
    14·2 answers
  • One of the earliest atomic models was suggested by John Dalton in the early 1800s
    14·1 answer
  • Is this single cell or multicellular ​
    13·1 answer
  • Which of the following would most likely
    13·1 answer
  • Which of the statements are true? Cell membranes in cold tolerant winter wheat plants have a higher ratio of unsaturated fatty a
    11·1 answer
  • Drag the tiles to the correct boxes to complete the pairs. Not all tiles will be used.
    11·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • All of the following is leading to less habitable land for human populations except
    8·2 answers
  • What event at letter b leads to elongation of the bone?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!