1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkinab [10]
3 years ago
5

What are the steps in protein structure prediction?

Biology
1 answer:
SVETLANKA909090 [29]3 years ago
3 0

Answer:

Although the specific prediction processes involved in different structural prediction methods vary greatly, the basic steps are generally the same, often including conformation initialization (including template recognition and ab initio modeling), conformation search, structure screening, all atom structure reconstruction, structure optimization, etc.

Explanation:

http://www.creative-biostructure.com/protein-crystallization-and-structure-determination_13.htm

You might be interested in
Anthropologists are suspicious of naturalizing discourses because
trapecia [35]
-They ignore historical evidence showing how present-day arrangements contrast with earlier social arrangements

- They direct attention away from current social inequalities, insisting that these inequalities are so deeply rooted that attempting to change them would be impossible.

-They ignore variations in social arrangements in other present-day societies, which show that social life may be organized differently
5 0
2 years ago
Why are there usually few organisms at the top of a food web?
Zina [86]
The organisms<span> that eat the producers are the primary consumers. They tend to be small in size and </span>there<span> are many of them. ... Because of this inefficiency, </span>there<span> is only enough </span>food<span> for a </span>few top<span> level consumers, but </span>there<span> is lots of </span>food<span> for herbivores lower down on the </span>food chain<span>.</span>
7 0
3 years ago
Which plant system is affected when the xylem tissue is removed?
Marysya12 [62]
The answer is A. Transport of water and minerals to the shoot system               
5 0
4 years ago
Read 2 more answers
4. Within an air mass, these characteristics are nearly the same:
zhenek [66]

Answer:

I think it is a let me know if it was right

7 0
3 years ago
A scientist wants to study the effect of vitamin C on colds. He gave 1000 mg of vitamin C per day to 100 people. What would be t
Anton [14]
D, I’m assuming that’s their is a another so you give on group nothing and the other group the vitamin C
5 0
2 years ago
Read 2 more answers
Other questions:
  • A cell in the leaf of a green plant performs both photosynthesis and cellular respiration, often at the same time. Which stateme
    14·1 answer
  • The thin surface layer of interconnected neural cells that covers the cerebrum is called the
    15·1 answer
  • Blank occur when the partially positive blank attract partially negative atoms nearby examples include the blank
    9·1 answer
  • How many amino acids cannot be made by the body
    6·1 answer
  • A population of animals feeds entirely on plants. Some of these animals are good at digesting Plant A, while others are good at
    12·2 answers
  • Describe two events that are common to both mitosis and meiosis that ensure the resulting daughter cells inherit the appropriate
    13·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Name the steps of mitosis illustrated in Diagrams A-D
    14·2 answers
  • A hawk eats a mouse. This kills the mouse, but it also means that the remaining mice will not have to compete as much for food w
    11·2 answers
  • Which pair of structures would provide a positive identification of an animal cell under a microscope?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!