1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sliva [168]
3 years ago
10

16 POINTS ANSWER!!!!!!!!!!!!!!!

Biology
1 answer:
alina1380 [7]3 years ago
7 0

Answer:b

Explanation:hope this helped sorry if it didn’t.

You might be interested in
A system of gene control in bacterial operons in which glucose is used preferentially and the metabolism of other sugars is repr
Levart [38]

Answer:

Catabolite repression

Explanation:

Catabolite repression is characteristic for prokaryotic organisms such as bacteria and this is the way to control metabolism.

It is called repression, because enzymes that are involved in other sugar's metabolism are inhibited (repressed). The system of catabolite repression have components such as:

  • sensory systems-detects ratios of glycolytic intermediates,
  • global regulators-control the expression of genes that encode for enzymes.
4 0
3 years ago
What is the role of helper t cells in the adaptive immune response?
Scorpion4ik [409]
Helper T cells <span>are required for almost all </span>adaptive immune responses<span>. They not only help activate B </span>cells to<span> secrete antibodies and macrophages </span>to<span> destroy ingested microbes, but they also help activate cytotoxic </span>T cells to<span> kill infected target </span>cells<span>.</span>
3 0
3 years ago
Read 2 more answers
Natural selection results in change over time by acting on traits that are ___
3241004551 [841]

Answer:

passed on, inherited, passed on to offspring, most adapted to the environment or have the best adaptive traits or higher genetic fitness

Explanation:

3 0
3 years ago
Read 2 more answers
What is the endoplasmic reticulum?
Jet001 [13]
Endoplasmic Reticulum is a long piece of membrane inside of the cytoplasm in a Eukaryotic cell. It connects to the Nuclear Membrane as well. It has numerous ribosomes attached as it helps with protein and lipid synthesis. It has both smooth and rough forms, each which do different things inside the cell.
5 0
3 years ago
In cellular reproduction, ___ ALWAYS occurs in 5’ to 3’ direction
attashe74 [19]

Answer:

DNA replication

Explanation:

DNA replication is the process whereby the genetic material (DNA) duplicates itself into two identical copies. This process must occur prior to any cellular division (meiosis or mitosis) in order to ascertain that each daughter cell gets an even and correct amount of DNA.

The process of DNA replication begins with the unwinding of the double stranded DNA molecule into two single strands of DNA. One strand called leading strand runs from 3'-5' while the other strand runs from 5'-3'. However, DNA replication proceeds in the 5'-3' direction.

4 0
3 years ago
Other questions:
  • A gyrus is an elevated ridge of cerebral tissue inward folds of cerebral tissue are called
    9·1 answer
  • Echinoderms have a(n)
    6·1 answer
  • Genes can be best described as
    6·2 answers
  • What causes amino acids to fold in different patterns to form different looking structures?
    10·1 answer
  • A student uses a computer program to determine the effects of increasing pollutants on the animals in a zoo. What is this kind o
    6·1 answer
  • What scientist proposed a link between contaminated water and cholera
    7·1 answer
  • Weather and climate result from interactions
    7·2 answers
  • 2. What is a feature of transcription? * 1 point Both strands of a DNA molecule act as a template for mRNA. Nucleoside triphosph
    13·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Why can’t penguin fly?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!