1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xeze [42]
3 years ago
7

How are extrusive and intrusive rocks alike

Biology
1 answer:
Veseljchak [2.6K]3 years ago
8 0

Answer:

Intrusive igneous rocks crystallize below Earth's surface, and the slow cooling that occurs there allows large crystals to form.

Explanation:

intrusive igneous rocks are diorite, gabbro, granite, pegmatite, and periodontist. Extrusive igneous rocks erupt onto the surface, where they cool quickly to form small crystals.

You might be interested in
Which type of reproduction is shown in the diagram?
Brums [2.3K]
The answer is binary fission
8 0
3 years ago
Read 2 more answers
Predators avoid the coral snake because it is poisonous. Predators also avoid the non-poisonous snake because it resembles a the
AlexFokin [52]
Mimicry should be the answer to this
5 0
3 years ago
1.
tensa zangetsu [6.8K]

Answer:

B

Explanation:

7 0
3 years ago
After nervous stimulation stops, calcium ions returning to the sarcoplasmic reticulum prevent ACh in the synaptic cleft from con
zhuklara [117]

Answer:

False.

Explanation:  

Neurotransmitter release occurs from the nervous terminal or varicosities in the neuronal axon. When an action potential reaches the nervous terminal, the neurotransmitter is released by exocytose. The molecule binds to its receptor in the postsynaptic neuron, triggering an answer. As long as the signal molecule is in the synaptic space, it keeps linking to its receptor and causing a postsynaptic response. To stop this process the neurotransmitter must be taken out from the synaptic space. There are two mechanisms by which the neurotransmitter can be eliminated:

• Enzymatic degradation/deactivation: There are specific enzymes in the synaptic space, which are in charge of inactivating the neurotransmitter by breaking or degrading it. The enzyme acetylcholinesterase prevents ACh from continuing to stimulate contraction.

• Reuptake: Receptors located in the presynaptic membrane can capture de molecule to store it back in new vesicles for posterior use. These transporters are active transport proteins that easily recognize the neurotransmitter.  

7 0
3 years ago
How does a mutation in the DNA affect the way proteins are made?
dem82 [27]
Point mutations are the substitution of a single nucleotide, which creates a different codon and therefore a different amino acid. the incorporation of a different amino acid in the protein can completely disrupt the normal function of proteins.
4 0
3 years ago
Read 2 more answers
Other questions:
  • During transcription, enzymes bind to a molecule of DNA. Then, the enzymes unwind and separate the DNA's double helical strands.
    5·1 answer
  • the average annual snowfall in owen sound, located in georgian bay is about 345 cm. Belleville, located in eastern ontario avera
    8·2 answers
  • Explain the composition the simplest chemical compound.
    13·1 answer
  • while some mutations can benefit an organism, others are harmful and can lead to cancer. which of the following best describes h
    6·2 answers
  • Contrast primary succession and secondary succession. Give an example of each.
    8·1 answer
  • In mold fossils the entire body of the organism is preserved true or false?
    13·1 answer
  • A recessive allele causes phenylketonuria (PKU) when homozygote. If the frequency of the recessive allele is 0.05 in the populat
    9·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Explain ur own answer. <br>need​
    7·1 answer
  • Which element has the most properties in common with calcium (Ca)?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!