1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex73 [517]
3 years ago
8

Having free earlobes (F) is a dominant trait in humans, and having attached earlobes (f) is Recessive. A Father has the genotype

ff, and the mother has the genotype Ff. What is the fathers phenotype?
Biology
1 answer:
svet-max [94.6K]3 years ago
4 0

Answer:Attached earlobes

Explanation: As the phenotype is a visible trait, and the father has ff (a recessive trait) he has the attached earlobes.

You might be interested in
The osmotic balance between blood and interstitial fluid is maintained by plasma proteins called
MakcuM [25]
The osmotic balance between blood and interstitial fluid is maintained by plasma proteins called albumins.
3 0
3 years ago
Which organisms are capable of converting gaseous nitrogen in the air into a form that other living organisms can use?
jekas [21]
Nitrogen Fixating bacteria ( such as cyanobacteria or clostridum) can convert gaseous nitrogen in the air into amonia, a compound that organism can use to make amino acid and other nitrogen-containing organic molecules
6 0
3 years ago
Read 2 more answers
Which of the following describes the process of deflation? A. The wind removes surface particles, resulting in lower land surfac
rjkz [21]
I am going to go with either C,A B.

I'm not entirely sure. it's just what i think
6 0
3 years ago
DO YOU THINK IT CAN BE COMPLEMENTED<br> WITH BIOMES? (The composting)
ladessa [460]

Answer:

yeah because some biomes r put n2 everything

Explanation:

6 0
2 years ago
Genetic drift simulation:
Airida [17]
Unlike natural selection, genetic drift does not depend on an allele's beneficial or harmful effects. Instead, drift changes allele frequencies purely by chance, as random subsets of individuals (and the gametes of those individuals) are sampled to produce the next generation.
8 0
1 year ago
Other questions:
  • Which factors characterize ecosystems? A. biotic factors only B. abiotic factors only C. both biotic and abiotic factors D. neit
    15·2 answers
  • list two factors that affect how important a particular greenhouse gas is in contributing to the greenhouse effect
    15·2 answers
  • Do carbon dioxide organize the elements to form glucose
    7·1 answer
  • Which of the following is the best description of the theory of evolution
    15·1 answer
  • How do gene interactions affect gene expression?
    5·1 answer
  • Evolution led to certain fishes, such as lung fishes to adapt to terrestrial mode of life. These fishes were the ancestors of mo
    15·2 answers
  • Which best describes the order of the technology used to transmit a sound through the radio? microphone → transmitter → micropho
    12·2 answers
  • Some members of this protozoan group cause red tide
    6·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • How is this trait probably inherited
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!