1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kolbaska11 [484]
3 years ago
5

The surgical creation of an artificial excretory opening between the ileum, at the end of the small intestine, and the outside o

f the abdominal wall is
Biology
2 answers:
leonid [27]3 years ago
7 0
<span>The answer is ileostomy
  Ileostomy is a surgical opening made in abdominal wall the surgical opening is also known as stoma. The ileum which is the lower end of the small intestine is brought out from this opening. This end is then stitched outside the body to collect digested food. It is used in conditions where large intestine fails to work.</span>
Alik [6]3 years ago
5 0
it is referred to as ileostomy. ileostomy is surgical procedure performed when the lower part of ileum are not functioning well. for instance, when the rectum and colon malfunctions a patient can be referred to undertake this type of surgery. the common reason for ileostomy is a disease referred to as inflammatory bowel disorder. the two types of inflammatory diseases include ulcerative colitis and Crohn's disease.  
You might be interested in
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
3 years ago
How does cactus survive without leaves<br>​
AveGali [126]
Thus, Cactus survive with the help of its "green stems" and "transpiration".
7 0
2 years ago
Explain what the greenhouse effect is and give an example of something it is similar to?
TiliK225 [7]

The greenhouse effect is the trapping of a stars warmth in the lower atmosphere of a planet by gasses in the air trapping the energy. This is similar to what actual greenhouses do, where they trap the warmth and humidity of the air inside it so plants can flourish. Farm animals produce a huge amount of the greenhouse gasses required for our planet to trap the suns warmth.

4 0
3 years ago
Please help w/ both asap I'll give brainliest
Bas_tet [7]

Answer:

number 1 is- c

number 2 is b

Explanation:

5 0
2 years ago
Read 2 more answers
A dilated vein that returns blood from the coronary circulation to the right atrium is the __________.
maw [93]
I believe its large blue vessel also known as vena cava
8 0
2 years ago
Other questions:
  • How is a fish similar to an oak tree
    10·1 answer
  • Which statement best describes the similarity between the recessive allele and the dominant allele?
    6·1 answer
  • Pls i need help??!!!<br> write a sentence contrast evaporation and condensation.
    14·1 answer
  • How do viruses collect and use energy
    13·1 answer
  • The ATP molecule shown consists of a base,__________, and a chain of three phosphates. A) cellulose B) maltose C) ribose D) sucr
    12·1 answer
  • What term describes the set of chromosomes matched together and labeled as numbered chromosomes?​
    15·1 answer
  • The cell cycle is controlled via a system of
    7·1 answer
  • Match each source of stem cells with the appropriate description.
    7·2 answers
  • What is glycolysis?<br>cuz i dont know​
    11·1 answer
  • I need help pls anyone know this ive been stuck for 10 mins so pls
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!