Can anything smaller than a cell be "living"?

Biology

1 answer:

Kisachek [45]4 years ago

7 0

No, because a cell is the smallest form of life

You might be interested in

How do the circulatory system and immune system work together to

ozzi

Answer:

Increased blood flow kills healthy cells which prevents infection at the site of the injury.

Increased blood flow carries white blood cells to the site of the injury.

Explanation:

7 0

3 years ago

Skeletal muscle:

Neporo4naja [7]

Skeletal muscle is: ( c. is attached to bone via ligaments).

7 0

3 years ago

Earth changes all the time, making it a _____ planet.

galben [10]

Earth changes all the time, making it a <u>dynamic </u>planet.

3 0

3 years ago

Read 2 more answers

Which of the following is NOT a characteristic of members of the Plant Kingdom?

aleksandrvk [35]

Plants are NOT heterotrophs. Heterotrophs are organisms that cannot produce their own food; generally these are animals.

5 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago