1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bumek [7]
3 years ago
9

Which energy source can be used in the greatest number of areas? geothermal energy, wind energy, hydroelectric power, or solar e

nergy.
Biology
2 answers:
Klio2033 [76]3 years ago
7 0
Wind energy because it's natural and some places dont have electricity.
IRINA_888 [86]3 years ago
6 0

Answer:

Option (4)

Explanation:

The sun is the ultimate and best source of energy. A large amount of area on earth receives sunlight that can use it conveniently. The energy that is obtained directly from the sun is known as solar energy. This solar energy is widely and efficiently used in order to produce electricity.

There are many advantages of solar energy such as-

  • Easily available
  • Cheap
  • Pollution-free
  • Renewable resource
  • Alternate for fossil fuel

Thus, the correct answer is option (4).

You might be interested in
Name an organ found in a human.list three tissueswhich make up this organ.
MariettaO [177]

Answer:

lunbryufitynunioufcwna

Explanation:

5 0
2 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
What would be the consequences for a cell if the cell membrane was not large enough to have adequate channels for bringing in nu
lyudmila [28]

Answer:

The cell would probably die

7 0
3 years ago
The pharynx functions as a passageway for __________, whereas the larynx functions as a passageway for __________.
uranmaximum [27]

The Pharynx is the passageway way for food

The Larynx is the passageway for air


<h3>Pharynx </h3>

The Pharynx is a long tube that is located in the throat region, it helps in the smooth passage of food from the mouth and down to the stomach where it is needed for body metabolism

<h3>
Larynx</h3>

The larynx helps in the free flow of air, it is sometimes called the voice box. It plays a vital function by blocking the windpipe from taking in food particles


For more information on Pharynx and larynx, please see the link below

brainly.com/question/9064940?referrer=searchResults

4 0
1 year ago
Give any two difference between digestive system in humans and digestive system in ruminants​
Otrada [13]

Answer:

Hey mate......

Explanation:

This is ur answer.....

<em>1</em><em>.</em><em> </em><em>Ruminant stomachs have four compartments, and monogastric stomachs have only one compartment. Ruminants are able to digest grasses and other fibrous feeds better than animals with monogastric systems can</em><em>.</em>

<em> </em><em> </em><em> </em>

<em>2</em><em>.</em><em> </em><em>The bacteria can digest fiber allowing the dairy cow to consume grass, forages, and fibrous by-product feeds that humans or monogastric animals cannot do effectively. The abomasum is the stomach compartment similar to the human stomach.</em>

Hope it helps!

Brainliest pls!

Follow me! :)

6 0
3 years ago
Other questions:
  • Which of the following traits is not considered an adaptation for early plant terristeral life
    7·1 answer
  • The ancient remains of plants preserved in the earth in the form of coal, oil, and natural gas are called
    11·1 answer
  • Several different species of birds, including heron, flamingos, and skimmers, can all successfully feed along the coast because
    13·1 answer
  • Resethelp 1. Structure describes the alpha-helices and beta-sheets that are formed by hydrogen bonding between backbone atoms lo
    9·1 answer
  • Cyanide is a poison that inhibits the electron transport chain by creating a strong and stable bond with Fe–Cu center in cytochr
    12·1 answer
  • Which part of the tongue is usually more sensitive to bitter substances such as soap?
    14·2 answers
  • Definition: This is an organism or cell with two sets of chromosomes
    7·1 answer
  • 1. How is the nervous system similar to other body systems? How is it different?
    5·1 answer
  • Which statements accurately describe fermentation? Select two options.
    7·2 answers
  • The term for genetic testing on embryos for genes that cause untreatable or severe diseases is:________
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!