1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Galina-37 [17]
3 years ago
6

In C3 plants the conservation of water promotes _____. In C3 plants the conservation of water promotes _____. photorespiration a

shift to C4 photosynthesis photosynthesis the opening of stomata the light reactions
Biology
1 answer:
julia-pushkina [17]3 years ago
6 0

Answer:

The correct answer is "photorespiration".

Explanation:

Photorespiration is a process in plants, where molecular oxygen is taken in a light-dependent  manner. Photorespiration is often considered a wasteful pathway because it competes with the Calvin cycle, which is much more efficient. In C3 plants the conservation of water promotes photorespiration. This occurs when the C3 plants close its stomata because the environment its too hot, or the carbon dioxide concentration drops to about 50 ppm.

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
The gas most frequently involved in medico-legal investigations is
raketka [301]
This is carbon monoxide.
hope this helps!
7 0
3 years ago
Define Hydrophobic. Which part of the membrane is<br> hydrophobic?<br> lin larma (cell)
Troyanec [42]

hydrophobic is the resistance of water (doesn’t mix). the lipid tails are hydrophobic.

8 0
3 years ago
Hawks are another major predator of rabbits. Rabbits in the wild tend to be light brown or brown speckled color. Occasionally th
Lostsunrise [7]

Answer:I’m pretty sure it’s A.

Explanation:

8 0
2 years ago
How in the world r wolfs endangered?!!!! They hunt in packs so humans would at least need a semi-automatic riffle or something l
Radda [10]

Answer:

Humans are a big reason for this issue. Things such as pollution, hunting, construction, and animal testing all effect the wolves population. Their food is hunted by humans so its harder for them to hunt, humans tear down trees and take over ground so theres less places to live, they might eat things like plastic because people litter, and things like dangerous weather can harm these animals.

4 0
3 years ago
Other questions:
  • Meredith completed an investigation involving earthworms. She placed a worm on a moist paper towel and carefully marked the posi
    15·2 answers
  • What percentage of the oceans floor is found in the abyssopelagic zone?
    7·2 answers
  • The type of anemia that is seen in severe folate deficiency is characterized by large, immature blood cells. This type of anemia
    8·1 answer
  • What is chemistry?
    11·2 answers
  • What pervasive theme in Northern Renaissance culture is implicit in Albrecht Altdorfer's The Battle of Issus
    10·1 answer
  • What is which sphere
    10·1 answer
  • What are the tissue parts of a plant? And what types of cells are in each area?
    8·1 answer
  • Primary structure refers to the amino acid sequence of a polypeptidePrimary structure refers to blank. Secondary structure refer
    15·1 answer
  • Litchen growing on rocks mechanical or chemical?
    9·1 answer
  • What happens when a saturated solution is cooled from 50°C to 30°C?<br>​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!