1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
devlian [24]
4 years ago
9

For the following linear system, put the augmented coefficient matrix into reduced row-echelon form.

Mathematics
1 answer:
Bingel [31]4 years ago
8 0

Answer:

The augmented matrix of the system is \left[\begin{array}{cccc}2&3&-1&14\\1&2&1&4\\5&9&2&7\end{array}\right].

We apply operations rows:

1. We swap row 1 and 2 and obtain the matrix \left[\begin{array}{cccc}1&2&1&4\\2&3&-1&14\\5&9&2&7\end{array}\right].

2. Of the above matrix we subtract row 1 from row 2 twice (R2 - 2R1) and we subtract row 1 from row 3, 5 times. (R3-5R1). We obtain the matrix \left[\begin{array}{cccc}1&2&1&4\\0&-1&-3&6\\0&-1&-3&-13\end{array}\right]

3. Of the above matrix we subtract row 2 from row1 twice (R3 - R2) and multiply the row 1 by -1 (-R2). Weobtain the matrix \left[\begin{array}{cccc}1&2&1&4\\0&1&3&-6\\0&0&0&-19\end{array}\right].

Since each pivote is an one then we conclude that the above matrix is the reduced row-echelon form of the matrix of the system.

You might be interested in
Solve for a. Show your work (ALL steps must be shown): -2(a-3)=12
irga5000 [103]

Answer

a= -6

Step-by-step explanation:

-2(a-3)=12

1.) -2(a)= -2a

2) -2(-3)= 6

3)  -2a+6=12

          -6    -6

4) -2a/-2 = 12/-2

a = -6

3 0
3 years ago
Need Answer Fast). The solution to a problem is an irrational number. which statement is true about the solution? ​Will Mark Bra
babymother [125]

Step-by-step explanation:

There is no option to choose from, but the knowledge of what irrational numbers are, would help cover this cost.

A rational number is a number that can be written as a simple fraction, a/b. Examples are 1/2, 5/6,...

If a number cannot be written as a simple fraction, then it is called irrational.

Example of irrational numbers: √2, π

7 0
3 years ago
Read 2 more answers
What does 10 = 4y equal to
boyakko [2]
69 ghcfhhggghjjohufdhhdjc
7 0
3 years ago
Read 2 more answers
Use the information to answer the following question.
Zanzabum

Answer:

C

Step-by-step explanation:

Since the difference between 0 and -10 is 10, this means that the difference between the diving board and the pool also has to be 10. Therefore, the diving board is 10 feet above the water since 0+10 is 10.

6 0
3 years ago
Read 2 more answers
Y-2=4(x+3) what the slope intercept
Kryger [21]

Answer:

Slope intercept form: y = 4x + 14

Slope: 4

Y-intercept: 14

Step-by-step explanation:

y - 2 = 4(x + 3)

Use distributive property

y - 2 = 4x + 12

y - 2 + 2 = 4x + 12 + 2

y - 0 = 4x + 14

y = 4x + 14

3 0
3 years ago
Other questions:
  • What is true of the coefficient of​ variation?
    8·1 answer
  • I'll GIVE BRAINLIST TO THE FRIST PERSON!!!!!!!!!!!!!
    13·2 answers
  • 2<br> Which expression is equivalent to 7a^3(6a^2+a)^2-4a^6?
    5·1 answer
  • (-6)(-7)= _____ what" please ASAP"
    9·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • The sum of three consecutive numbers is 123. what is the smallest of the three numbers
    13·2 answers
  • Write a linear function f with the values f (0) =4 and f(3)=-8
    12·1 answer
  • Someone help me! PLS DONT SKIP
    7·2 answers
  • Enter the values of x, y, and z. The diagram is not to scale.
    12·1 answer
  • Jamal's deck is in the shape of a polygon and is shown on the grid below.(-8,6)(6,6)o[(-8, -4),(6,-4)What is the area of Jamal's
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!