1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PSYCHO15rus [73]
3 years ago
15

How does the flu affect businesses and governments? Could it affect residents’ access to certain resources?

Biology
1 answer:
Dovator [93]3 years ago
6 0

Answer:

Ofcourse it does

Explanation:

Imagine one person have flu and he or she goes to met someone who is healthy but when they talk other infected person's flu goes to other healthy person and that new infected person goes to another and they go to another and thats how it seperate. But we have solution for this the first infected person need to wear mask so that his or her flu don't pass out to anothers.

You might be interested in
Which statement accurately describes the relationship between the brain and addiction?
yKpoI14uk [10]

C. A higher amount of addictive chemicals are needed to get the same high when fewer receptors are present...

4 0
3 years ago
What are preserved remains that shed light on past animals?
Daniel [21]
The answer would be fossils since they are they remains of past life forms
3 0
3 years ago
How does the fossil record provide evidence for evolution?
Lena [83]

Answer:

A. It Shows that organisms have changed over time.

Explanation:

5 0
3 years ago
Read 2 more answers
705 over 224 divide by 224 over 224
dybincka [34]
(705/224) / (224/224)
224/224 = 1.
So (705/224) / (224/224) = (705/224) / (1/1).
Dividing 2 fractions is equal to multiplying the first fraction by the inverse of the second:
(705/224) / (1/1) = (705/224) * (1/1) = 705/224.

Hope this Helps! :)
5 0
3 years ago
De donde ___ tu? A.estas B.es C.eres D.esta
musickatia [10]

Answer:

De dónde ERES tu?

Explanation:

C. Eres

6 0
3 years ago
Read 2 more answers
Other questions:
  • The relative age of something is the exact number of years since an event has occurred true or false
    15·1 answer
  • Help please ?????????
    11·2 answers
  • Which feature is not found in all cells
    9·2 answers
  • Genotype of a pure line
    9·1 answer
  • Vestibular senses, kinesthetic sense, and skins senses all make up:
    10·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which cell organelle is the site for photosynthesis? A. chloroplast B. endoplasmic reticulum C. Golgi apparatus D. lysosome
    15·1 answer
  • Major organs form and cells continue to divide in the __________ stage.
    11·2 answers
  • I'll give you a brain list if you help me.
    8·1 answer
  • Rejection of a newly translated organ caused by ..
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!