1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blababa [14]
3 years ago
9

In which direction does Earth rotate?

Biology
2 answers:
makvit [3.9K]3 years ago
8 0

Answer:

Eastward around its axis

Explanation:

Just took the test review on edgen and got it right

Eddi Din [679]3 years ago
7 0

Answer:

The answer is  its eastward around its axis

Explanation: 

You might be interested in
DNA fragments show up as a series of different sized ______.
Doss [256]
Question : DNA fragments show up as a series of different sized ______.


Logical Answer :  Bands
5 0
3 years ago
What is the function of nitrogen-
Effectus [21]
I think the answer is C
8 0
3 years ago
What combines to form rocks<br><br>minerals <br>Crystal's<br>other rocks​
vampirchik [111]

Answer:

A rock is a collection of minerals. In a cooling lava, mineral crystals do not have time to form and are very small. The chemical composition will be the same as if the magma cooled slowly. Existing rocks may be heated enough so that the molecules are released from their structure and can move around.

Explanation:

6 0
2 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Louis Pasteur contributed all of the following to Germ Theory EXCEPT
motikmotik

microbes made beverage and food go bad

7 0
3 years ago
Other questions:
  • What happens when a hypothesis is not supported
    11·1 answer
  • Which group of plants contains the least number of species?
    11·2 answers
  • Which statement about wind energy is correct? A. Wind energy is a renewable resource that can meet all of the United States's el
    9·1 answer
  • During the Paleocene-Eocene Thermal Maximum, when global surface temperatures spiked, we observe temperate forests _____________
    15·1 answer
  • Most food chains have four or five links, with each link representing a feeding step. Organisms are placed into a food chain acc
    12·1 answer
  • Why do plants not need heterotrophs
    10·1 answer
  • The modern synthesis theory states that evolution occurs through changes in the gene pool of _____.
    9·2 answers
  • (80 POINTS AND BRAINLIST!!!!!!!!)
    9·1 answer
  • How many fundamental forces exist in nature?<br> two<br> three<br> four<br> five
    6·2 answers
  • Someone answer 8 pls
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!