1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Irina-Kira [14]
3 years ago
6

A _____ is used to reveal the detailed internal structure of a cell.

Biology
1 answer:
gladu [14]3 years ago
8 0

Answer:

The correct answer will be- Transmission electron microscope

Explanation:

A Microscope is an optical instrument designed to view the microscopic things which could be living or non-living around us.

The internal structure of a microscope can be viewed by a light microscope mainly dark-field microscope but a detailed structure of a microscope can be viewed by an electron microscope mainly a transmission electron microscope.

The transmission electron microscope studies the internals structure of the cell by creating the 2D images by passing the beam of electrons through the specimen.

Thus, a transmission electron microscope is the correct answer.

You might be interested in
A plant uses a gas from the air to make sugar during photosynthesis. This process is part of the..
Anit [1.1K]

Answer:

Plants are autotrophs, which means they produce their own food. They use the process of photosynthesis to transform water, sunlight, and carbon dioxide into oxygen, and simple sugars that the plant uses as fuel.

Explanation:

3 0
3 years ago
What is hibernation ?​
lana [24]
Hibernation is a way animals conserve energy to survive adverse weather conditions or lack of food.
7 0
2 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
An organism that eats other organisms is called a...
horrorfan [7]

An organism that eats other organisms is called a <u><em>heterotroph</em></u>.

3 0
3 years ago
There is 19% adenine in a strand of dna.what % is guanine
Mkey [24]

Answer:

28% guanine

Explanation:

5 0
3 years ago
Other questions:
  • WILL GIVE A BRAINLEST
    6·2 answers
  • Which of these is not a component of a molecule of adenosine triphosphate (ATP)?
    11·1 answer
  • Which protein functions as a motor protein that applies the power stroke during muscle contraction? which protein functions as a
    14·1 answer
  • Human blood has four basic parts. Which part is matched with the correct function?
    5·2 answers
  • Meaning of onion epidermal cell​
    8·1 answer
  • Mitosis makes.....<br> A. cell phones<br><br> B. identical body cells<br><br> C. sperm and egg cells
    7·2 answers
  • Como la reducción de impuestos ayuda a la economía
    14·1 answer
  • A __ is a moderately wet and mild biome with four distinct seasons. Many trees are present with most annually losing their leave
    13·1 answer
  • A red flower and a flower with red and white spots are crossed. What is the percentage of them having an all red flower
    12·1 answer
  • Type 3 claims explains why water levels mead have changed?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!