1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lbvjy [14]
4 years ago
12

Julie spends every saturday volunteering at the hospital. While there she visits children in the department for babies born with

addiction from addicted birth mothers. Which personal value most likely directly influences her actions
Health
1 answer:
dimaraw [331]4 years ago
6 0
I would think compassion or maybe exploration. 
You might be interested in
Sheryl was diagnosed with bipolarity when she was a teenager. She’s hesitant to tell her friends, and tries her best to hide her
bekas [8.4K]

Answer: A

Explanation: mental illness despite being helped with meds, don't typically go away.

8 0
3 years ago
Read 2 more answers
1. What is the importance of filling out a medical<br> histor
Nataliya [291]

Answer:

Doctors will be able to gain a patients medical history. they can determine what medications or treatment that they can give to their patient.

Explanation:

3 0
3 years ago
Read 2 more answers
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
Which of the following is a benefit of fitness walking
Alchen [17]

The answer is B, because the other ones either have nothing to do with fitness or are not benefits.

8 0
4 years ago
Read 2 more answers
Which organism is an autotroph?
lorasvet [3.4K]

Answer:

D

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • what percentage of North America adults may be functioning below their potential due to prolonged exposure to stress
    11·1 answer
  • When it comes to our health and the treatment of diseases, technology has had a effect?
    12·1 answer
  • What has an impact on a person's exercise habits?
    7·1 answer
  • Which part of the body doesn't require a warm-up before exercise?
    10·1 answer
  • List the following four activities in the order they would go in the physical activity pyramid from top to bottom.
    6·1 answer
  • Researchers use a measure of ____________ to determine a person's self-perceived happiness or satisfaction with life.
    8·1 answer
  • Which energy is present in a stone kept on the top of tower<br>​
    13·1 answer
  • Serving a resident the wrong diet is an example of?
    5·1 answer
  • Description of all 4 Fitt Principles
    10·2 answers
  • Hey you, yes you.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!