1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viktor [21]
4 years ago
8

What organisms help you to breath?

Biology
1 answer:
Katen [24]4 years ago
8 0
I think the answer is trees

You might be interested in
Which sense would you expect a deep-ocean organism to rely in the least
Phantasy [73]
They should rely less on sight because the deeper you go down the less sunlight the reaches down because it refracts and gets dispersed. So it could be the middle of the day and it would look like the middle of the night down there.
3 0
3 years ago
Which of the following events would result in allopatric speciation?
enot [183]

Answer:

An earthquake that isolates a population of rodents on a mountain from other populations of rodents

Explanation:

7 0
3 years ago
Why would the location of resources be a concern?
balu736 [363]
The answer is D) All of the above
7 0
3 years ago
Read 2 more answers
Why do you think molds are not growing all over everything around you?
Olegator [25]

Because:

Not everything around you has the correct moisture to grow mold. Places like a shower, wood, and even toilets do, since water will soak into them, or the water is trapped. If you don't clean your shower and toilet, you will notice mold. If you look at a fence, there is probably hints of mold on it.

Something like a shelf cannot grow mold, since it usually has paint on it, and the moisture won't go through something like paint.

Another possible answer: Since the areas around you don't always have the correct moisture, mold will not grow on everything. It can grow on some stuff in your house, but not everything around you.


If you need any more help, let me know !

7 0
3 years ago
Which supports the idea that birds and butterflies both have wings but they do not have a common ancestor with wings?
faltersainse [42]

Birds and butterflies don't have a common ancestor because one is a member of a insect and the other is well a bird. They both have different body structure. One has bones and the other has an exoskeleton. hope this helps  

3 0
4 years ago
Other questions:
  • Determine whether each phrase describes an enzyme, an active site, or a substrate. move each phrase to the category it describes
    15·2 answers
  • Start with the P generation with the following genotypes (AA x aa). Based on classical Mendelian inheritance, how will a cross b
    13·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Why preservation of animals in sea is best as compared to preservation in land?
    7·1 answer
  • how is the male reproductive system different from other body systems? it isn’t necessary to vital signs. it monitors other body
    14·2 answers
  • 7th grade science plz help !!
    15·1 answer
  • NEED ANSWER ASAP. Individuals with advantageous traits for their environment have a better chance of surviving
    10·1 answer
  • Continental plates are __________ than Oceanic Plates <br> 1.) more dense<br> 2.) less dense
    12·2 answers
  • What’s the answer???
    10·1 answer
  • The zone of the epiphyseal plate that is nearest the epiphysis and contains randomly arranged chondrocytes is the zone of ______
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!