1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ExtremeBDS [4]
3 years ago
15

A complex culture in which large numbers of human beings share common elements

Biology
1 answer:
Kobotan [32]3 years ago
6 0

Answer:

a

Explanation:

You might be interested in
Choose all the right answers.
FinnZ [79.3K]

Answer:

go through a metamorphosis

Explanation:

METAMORPHOSIS is the change in the form and often habits of an animal after the embryonic stage during normal development.

For Example: the transformation of a caterpillar into a butterfly, OR a tadpole into a frog.

Note that the other options given are WRONG because they are characteristics or features of either of them, NOT both.

6 0
3 years ago
Using jargon, or overly complex terms, can contribute to ________ noise
Illusion [34]
Answer is: <span>Using jargon, or overly complex terms, can contribute to semantic noise.
There are four forms of communication noise: </span>psychological<span> noise, physical noise, </span>physiological<span> and </span>semantic<span> noise.
</span><span>Semantic noise occurs when</span> sender of the message uses a word or a phrase (complex terms) that we don't know the meaning of.
6 0
4 years ago
categorize the following characteristics based on whether they are describing chloroplasts or mitochondria.
Ghella [55]

The categorization of the characteristics based on whether they are describing chloroplasts or mitochondria are as follows:

  1. <u>Mitochondria:</u> carry out cellular respiration.
  2. <u>Chloroplasts:</u> carry out photosynthesis.
  3. <u>Mitochondria:</u> found in plant and animal cells.
  4. <u>Chloroplasts:</u> produce carbohydrates used as source of food for most living things.  
  5. <u>Mitochondria:</u> abundant in human muscle cells.
  6. <u>Chloroplasts:</u> not found in animal cells.
  7. <u>Chloroplasts:</u> contain chlorophyll.

<h3>What is a cell?</h3>

A cell can be defined as the fundamental functional, structural and smallest unit of life, which is found within the body of an organism.

Some examples of cell organelles that are found in the body of an organism include the following:

  • Mitochondria.
  • Nucleus.
  • Endoplasmic reticulum (ER).
  • Vesicles.
  • Cytoplasm.
  • Cell membrane.
  • Chromosome.
  • Golgi apparatus (bodies).
  • Chloroplast

<h3>What is mitochondria?</h3>

Mitochondria can be defined as one of the cell organelles that is found in the body of a living organism.

Also, mitochondria is known as the powerhouse because it is saddled with responsibility of providing all the energy required in the cell, especially by transforming energy forms through series of chemical reactions.

Read more on mitochondria here: brainly.com/question/14861274

#SPJ1

<u>Complete Question:</u>

Categorize the following characteristics based on whether they are describing chloroplasts or mitochondria.

Chloroplasts Mitochondria

Carry out cellular respiration

Carry out photosynthesis

Found in plant and animal cells

Produce carbohydrates used as source of food for most living things  

Abundant in human muscle cells

Not found in animal cells

Contain chlorophyll

3 0
1 year ago
Which compounds interact to form proteins
eimsori [14]

Answer:

amino acids are linked with peptide bonds

4 0
3 years ago
Read 2 more answers
What best describes errors and periods?
blondinia [14]

Answer:

A forecast with a large cumulative sum of forecast errors

Explanation:

8 0
3 years ago
Other questions:
  • Effects of joint alignment and type on mechanical properties of thermoplastic articulated ankle–foot orthosis.
    10·2 answers
  • A mutation that occurs in a skin cell of a fully grown zebra might prevent the production of a protein needed to make hair black
    13·1 answer
  • What are the three most commonly used instruments for the determination of free-living physical activity and energy expenditure?
    10·1 answer
  • How many pairs of spinal nerves are there?
    11·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • List at least one cranio-dental characteristics that group proconsul with hominoids to the exclusion of cercopithecoids.
    13·1 answer
  • HELP!!!
    8·1 answer
  • Your friend nods back and forth to you, making the "yes" motion. What muscles are involved in this ‘yes’ motion? Select all that
    14·1 answer
  • A student uses gummy worms to model the process of mitosis. The model is shown below.
    14·1 answer
  • Advances in medical technology and healthcare have increased the life expectancy of people around the world. What negative effec
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!