1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Akimi4 [234]
3 years ago
11

Members of Chondrichthyes are thought to be descended from fishes that had ________.

Biology
1 answer:
ella [17]3 years ago
6 0

The correct answer is B. A bony skeleton

Explanation:

In biology, Chondrichthyes are mainly marine jawed fishes that have cartilage skeletons rather than bone skeletons and also they have paired fins, this includes animals such as rays and sharks. In terms of origin, it is believed this type of fishes are mainly linked to placoderms that were a type of primitive fish that lived during the Devonian period that had a body skeleton as they were covered by hard structures called plates made of bone. Because of this, it is believed this structures evolved into less rigid ones made of cartilage although both the primitive fish and modern Chondrictyles share features such as the structure of jaws. Therefore, Chondrictyles descended from fishes that had a bony skeleton.

You might be interested in
What would happen to a flower if it had dark petals or no petals at all?
nadya68 [22]

Answer:

it might catch to much sun with black petals or no sun at all with none so in other words it  would probably die.

Explanation:

white reflects heat, black attracts heat

4 0
3 years ago
. the negatively charged part of an atom
Slav-nsk [51]

Answer:

Electrons are the negatively charged particles of an atom. Together, all of the electrons of an atom create a negative charge that balances the positive charge of the protons in the atomic nucleus. Electrons are extremely small compared to all of the other parts of the atom. The mass of an electron is almost 1,000 times smaller than the mass of a proton.

Explanation:

I hope this helped!

5 0
3 years ago
Please help.. I don't understand!!
Kipish [7]

all d before I go this answer

6 0
3 years ago
4. The density of water is 1g/ml. Knowing this, do you think either the dice or book would float in water? Why
Tanzania [10]
The dice would be able to float bc of mass
3 0
3 years ago
In a DNA molecule the ratio of adenine (A) molecule to thymine (T) is 1:1. If in a strand of DNA there are 1 million A molecules
lesantik [10]
The correct answer is A) 1 Million
7 0
3 years ago
Other questions:
  • Which of these organic molecules functions to help speed up biological chemical reactions?
    15·1 answer
  • True or false an objects mass is less on the moon than it is on earth
    14·1 answer
  • 8 letter word: living thing that eats other living things ( _ _ _ s _ _ _ _ )
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What is your opinion on cloning animals? Extended answer plz
    9·1 answer
  • Do you think that carbon emissions from humans should be regulated? Why or Why not? Give at least five reasons to support your a
    5·1 answer
  • pls help me with this immediately!!! and pls give me the correct answer and don’t guess or leave a link.(i’ll be giving brainies
    8·1 answer
  • PLEASE HELP. Explain how the earth is a system? The more detail you can provide, the better!
    15·2 answers
  • The movement of molecules down a concentration gradient through transport proteins in the cell membrane is a type of
    12·1 answer
  • Genetic variation among humans is relatively small when compared to other species. Where in the human genome does most of the di
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!