1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
7nadin3 [17]
3 years ago
8

What does meat have in itself​

Biology
2 answers:
storchak [24]3 years ago
4 0

Lots of proteins vitamins and minerals for the human body ^_^

DaniilM [7]3 years ago
3 0

Answer:

Meat is the only nutritionally complete food. Animal foods (particularly when organ meats are included) contain all of the protein, fat, vitamins and minerals that humans need to function.

Ingredients in processed meat:

A typical ingredient statement might list "beef, pork, water, hydrolyzed vegetable protein, salt, dextrose, corn syrup, hydrolyzed milk protein, sodium phosphate, natural spices, smoke flavoring, sodium erythorbate, sodium nitrite."

  • (\) QueTooOfficial (/)

You might be interested in
How does a tree use Cellular Respiration to store carbon?
Bogdan [553]

Answer:

In-spiration Respiration in trees releases energy stored in carbon compounds through a controlled process. Aerobic respiration uses O2 to oxidize organic compounds into CO2 and H2O. Energy released is stored within living cells as ATP, ETM, and a proton bank which are easily used for cell work.

Explanation:

You can put it into ur own words.

3 0
3 years ago
Porque el ventriculo izquierdo tiene una pared muscular mas potente que la del ventriculo derecho?
garri49 [273]
<span>Because the left ventricle has a stronger muscular wall than the right ventricle?</span>
8 0
4 years ago
The absorption of which vitamin increases in older adults? a b12 c d
balandron [24]
I believe that would be vitamin A, because vitamin A generally increases with age.
Hope it helps!
4 0
3 years ago
Which of these cities from Australia is not coastal?
romanna [79]
All of them are coastal
5 0
3 years ago
Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5′−GGCCCUUUUACCCGGUUUU−3′
Blizzard [7]

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

4 0
4 years ago
Other questions:
  • What is a simple statement predicting the results of a controlled scientific experiment
    8·1 answer
  • Carbon dioxide is not considered an organic molecule. Photosynthetic organisms turn it into an organic molecule in the form of a
    9·2 answers
  • Oven cleaner is a highly caustic chemical that reacts with baked on foods. It is dangerous to the touch and has a very slippery
    14·2 answers
  • Interactions between the red blood cell and important molecules, cells, and organs
    6·1 answer
  • Find 8 elements named after towns
    5·1 answer
  • Which SI unit is more appropriate for measuring density?
    14·2 answers
  • Will give brainliest and 20 pts if answered plz:)
    13·2 answers
  • Which characteristics do birds and mammals share? Check all that apply.
    7·2 answers
  • Directions: Select the correct term or terms from the table. Different organisms have different traits, or characteristics. Some
    13·1 answer
  • Why 'light spread' causes different temperature:
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!