Dividing a cell into more than one cell is called splitting.
Answer:
heat, density, boiling point
Answer:
option 1
Explanation:
In assemblying the nucleosome, this reaction occurs in two main steps. the H3 and H4 are recruited first to the DNA in pairs forming the H3/H4 tetramer; meaning two of H3 and two of H4. This gives rise to the nucleosome precursor. Then after this, the dimers of both H2A/H2B are recruited to this precursor, to give rise to the octamer structure around which the DNA is wrapped.
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.