1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
soldier1979 [14.2K]
3 years ago
15

How long are dogs pregnant?

Biology
1 answer:
zhannawk [14.2K]3 years ago
3 0
It's 58 to 68 days
It is known as Gestation period
You might be interested in
Dividing a cell into more than one cell is called __________.
UkoKoshka [18]
Dividing a cell into more than one cell is called splitting.
5 0
3 years ago
This graph shows how the lynx and snowshoe hare populations can vary over time. How would the snowshoe hare population change if
ivann1987 [24]
It would decrease. hope this helps
7 0
3 years ago
Read 2 more answers
Name & explain the properties of water
Luba_88 [7]

Answer:

heat, density, boiling point

3 0
3 years ago
In assembling a nucleosome, normally the …(1) histone dimers first combine to form a tetramer, which then further combines with
Readme [11.4K]

Answer:

option 1

Explanation:

In assemblying the nucleosome, this reaction occurs in two main steps. the H3 and H4 are recruited first to the DNA in pairs forming the H3/H4 tetramer; meaning two of H3 and two of H4. This gives rise to the nucleosome precursor. Then after this, the dimers of both H2A/H2B are recruited to this precursor, to give rise to the octamer structure around which the DNA is wrapped.  

7 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Other questions:
  • If an animal leaves a footprint in soft mud, what type of fossil may be made?
    12·2 answers
  • Which of the following is an example of an abiotic factor?
    10·2 answers
  • The law of ___ b elps explain why the density of air as the altitude above earth's surface increases
    7·2 answers
  • Vibrio cholerae produces a toxin that binds to a plasma membrane receptor on intestinal cells of the host. The toxin permanently
    10·1 answer
  • The rate at and the extent to which a nutrient is absorbed and used is referred to as its ____.
    10·1 answer
  • What is the correct sequence that an organism developed??
    6·1 answer
  • Verdadero o falso:
    8·1 answer
  • How many codons equals 1 amino acid?
    6·1 answer
  • A scientist is examining a single-celled organism that is often found in the human body; some examples of this organism are help
    13·2 answers
  • Are data that do not support a hypothesis useful?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!