1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dem82 [27]
3 years ago
11

How might a substrate of the citric acid cycle block respiration when it is present in great excess

Biology
1 answer:
murzikaleks [220]3 years ago
4 0
The substrate of the citric acid cycle which can block respiration when it is present in excess is MALONATE. Malonate inhibits respiration by competing with succinate dehydrogenase for its acitve site. Malonate binds to the active site without reacting, thus competing with succinate. This disrupts the cellular respiration in the cell.
You might be interested in
Food webs diagram the complex relationships of energy flow in an ecosystem containing a variety of producers and consumers. A di
snow_lady [41]
The answer would be D
4 0
3 years ago
What is the name of the process of RNA formation from DNA?
Komok [63]
The process of RNA formation from DNA is transcription. 
6 0
3 years ago
Read 2 more answers
The cerebellum is important in the control of __________.
astra-53 [7]
D! Voluntary Movements
5 0
3 years ago
Why are both primary and secondary resources important when you’re researching?
shtirl [24]

Answer:

Most research uses both primary and secondary sources. They complement each other to help you build a convincing argument. Primary sources are more credible as evidence, but secondary sources show how your work relates to existing research.

Explanation:

There you go, have an awesome daaay :)

6 0
3 years ago
Explain the krib cycle​
Yuki888 [10]

Answer:

The Krebs Cycle, also called the citric acid cycle, is the second major step in oxidative phosphorylation. After glycolysis breaks glucose into smaller 3-carbon molecules, the Krebs cycle transfers the energy from these molecules to electron carriers, which will be used in the electron transport chain to produce ATP.

7 0
3 years ago
Other questions:
  • A client with vesiculopustular lesions with honey-colored crusts on the face visits a primary healthcare provider. which bacteri
    9·1 answer
  • What are the three main levels of biodiversity
    12·1 answer
  • How do scientists determine when an era ends and an era begins
    8·1 answer
  • Which cell structure is responsible for supplying energy in both plant and animal cells?
    6·1 answer
  • The process of making an identical copy of a section of DNA, using existing DNA as a template for the synthesis of new DNA stran
    15·1 answer
  • if you had been older in 2017, would you have driven to Oregon to see the total solar eclipse? Explain your answer.​
    11·1 answer
  • Which of the following are matched correctly? (choose all that
    8·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Describe conduction and give an example
    6·1 answer
  • Recycling of car batteries can help to do what to lead?​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!