1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vikki [24]
3 years ago
6

How many cells make up a unicellular organism?

Biology
2 answers:
Masteriza [31]3 years ago
5 0
A unicellular organisms only has ONE cell
Bas_tet [7]3 years ago
3 0

"uni" means 1 so it only have one

You might be interested in
How do mutations cause variation?
Fofino [41]

Answer:

Mutations can create entirely new alleles in a population which changes the allele frequencies of a gene pool.

5 0
3 years ago
Seeds are a derived character of the spermatophytes. All of the plants in this clade reproduce using seeds. However, embryo form
Natasha2012 [34]

Embryophyta is a clade within the Phragmoplastophyta, a larger clade that also includes several green algae groups. Embryophytes are the plants growing on land which include hornworts, liverworts, gymnosperms, flowering plants etc while green algae mostly thrive in aquatic environment.

The conduction of water requires vascular tissue called xylem. In green algae, it is not necessary to have water conducting tissue as the entire body is in contact with water. However in embryophytes, having a vascular tissue is an adaptation that ensures to provide water to the higher parts of the plant which is not directly in contact with the soil.

4 0
3 years ago
Help me asap! Plz plz
dlinn [17]
A) Smooth muscle 
B) Involuntary 
C) Cannot 
D) Brain
E) Move 
F) Digestive 
G) Voluntary 
8 0
3 years ago
Why is osmosis important to cell function???????
laiz [17]
It helps move wastes out of the cell and allows water and nutrients to move into the cell
7 0
3 years ago
Read 2 more answers
Please help with short note on evolution.<br>​
qwelly [4]
Charles robert darwin
3 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • A good conclusion restates the hypothesis so that the reader
    7·2 answers
  • Which type of environmental scientist is likely to study the interactions of gorillas?
    5·2 answers
  • What determines the genotype of an organism
    6·1 answer
  • which structure of the respiratory system plays the main role in carry out the system’s primary function? trachea pharynx alveol
    8·2 answers
  • The ____ is the part of the peripheral nervous system that directs the activity of glands, organs, and smooth muscles.
    8·1 answer
  • What theory of hearing contends that the entire basilar membrane vibrates as a whole in response to a sound?
    12·1 answer
  • The cell membrane is said to be semipermeable because
    5·1 answer
  • If someone has both an x and y chromosome what gender at birth are they ?
    6·1 answer
  • Which are false ;-;
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!