1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
o-na [289]
3 years ago
8

Helppppppppppppppppppppppppppppppp

Biology
1 answer:
jarptica [38.1K]3 years ago
5 0

The Anser would be [<u>Group 3]</u>.

Why Biotic: Is a Living thing so Fish, Consumer, Producer

You might be interested in
What is the advantage of sexual reproduction over asexual reproduction in organisms
IgorLugansk [536]
Asexual only involves one living organism.........and yeah
8 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Atoms with a low electronegativity, like calcium, might bond with ____________.
TiliK225 [7]

The answer is A.The calcium atom must bond with an atom of high electronegativity (like fluorine) because the higher electronegativity atom will bully the low electronegativity atom and take away its electrons.

These are the choices:

A. an atom with a high electronegativity, like fluorine

B. another atom with a low electronegativity, like lithium

C. another atom that would like to share electrons

D. no other atoms because it's too weak to bond with anything


7 0
3 years ago
Read 2 more answers
Which term refers to a change in one species that results from a change in another species that it interacts with?
Mrac [35]
The answer is coevolution.

Coevolution is a change in <span>one species that results from a change in another species that it interacts with. For example, some species of orchid and African moth coevolved. That was a consequence of African moths' dependence on flower nectar and the orchids' dependence on moths' help in pollination. This two species coevolved, therefore the orchids have deep flowers while African moths have long proboscides.</span>
6 0
3 years ago
Read 2 more answers
If George is spanked immediately after his baby sister cries, he is likely to become fearful every time she cries. If Ken is spa
julia-pushkina [17]

Answer:

Associative learning may be defined as a type of learning in which the new response gets easily associated with the stimulus. Except habituation learning all simple learning procedure are included in this learning.

In the associative learning, reactions of an individual are based on there spank. George learns to cry on being spanked this is because this stimulus of sister cries gives response. Crying do not show any effect on ken because he does not know about his sister crying.  

5 0
3 years ago
Other questions:
  • Which process or stage occurs during incomplete metamorphosis?
    14·2 answers
  • A young child classifies animals into 26 groups according to the alphabet. For example, the first group of animals in this schem
    12·1 answer
  • Environmental science help!
    12·1 answer
  • Based on the diagram above, which of the following describes the role of organ A?
    11·2 answers
  • Can cut in half centipedes still live?
    10·2 answers
  • Why are formulas used to describe substances
    12·1 answer
  • Before the glucose food can be used by a cell, it must first be transferred into an usable form of energy known as
    7·2 answers
  • Carbohydrates and lipids are important molecules found in living things.
    7·1 answer
  • 4. Which of the following conclusions about science is best supported by the text?
    6·1 answer
  • How fast does a humming birds wing flat per second?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!