1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elina [12.6K]
3 years ago
13

Moshe is a writer. He is creating content for a informative chart to be placed near the coral reefs for the visitors to the reef

s . How should he describe the reef crest
Biology
1 answer:
kondaur [170]3 years ago
6 0

Explanation:

Coral reefs are situated in humid oceans close to the equator. The major coral reef is the Great Barrier Reef in Australia. The subsequent main coral reef is situated off the shore of Belize, in Central America. Further reefs are situated in Hawaii, the Red Sea, and other areas in humid oceans. Coral ecosystems are a basis of nutrition for millions; shield the shorelines from hurricanes and erosion; offer home, to reproducing and nursery grounds for economically important fish species; provide jobs and income to local economies from fishing, recreation, and tourism; are a source of new medicines etc. Coral reefs begin to form when free-swimming coral larvae attach to submerged rocks or other hard surfaces along the edges of islands or continents. As the corals grow and expand, reefs take on one of three major characteristic structures —fringing, barrier or atoll.

You might be interested in
In what ways is carbon dioxide added to the environment through the carbon cycle? What
lesya [120]

Answer:

1) respiration 2) photosynthesis.

Explanation:

5 0
3 years ago
What is the basic premise of the big bang theory
Lesechka [4]
That the universe was created at one time with a huge bang.
5 0
3 years ago
Which sentence best describes the function of nucleic acids?
VMariaS [17]
Statement 3 is the best choice
8 0
3 years ago
What type of mutation has occurred in the following example? Original DNA sequence С т с Original amino acid sequence Glutamic a
Alex73 [517]

Answer:

b

Explanation:

6 0
3 years ago
How often is carbon dioxide cycles through the atmosphere
Alex
10-100 million metric tons of carbon move through the slow carbon cycle every year.
6 0
3 years ago
Other questions:
  • Some plants respond to light with a sudden enlargement of their leaf pores. this response is important because it enables the pl
    5·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Explain how carboxyhaemoglobin leads to death<br>​
    15·1 answer
  • What term describes the early kind of biologists that made and recorded observations about organisms in natures
    15·2 answers
  • Geographic isolation may result in<br> A. extinction<br> B. speciation
    10·2 answers
  • Cell ______ is the process during which cells become progressively restricted in their developmental potential.
    6·2 answers
  • In the walls of the heart, two layers of tissue form a sandwich around a thick layer of muscle called the ______________________
    6·1 answer
  • Please help<br><br> Write the equation for cellular repiration.
    11·1 answer
  • What is one kind of food the instructions say can be used to feed worms in the worm farm? O carrots​
    8·1 answer
  • An effective short-term remediation strategy for the pond would be to.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!