1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
skelet666 [1.2K]
3 years ago
12

A tubal ligation is a permanent sterilization procedure in which a woman's fallopian tubes are blocked or severed. Which of the

following explains how this process can be used to prevent pregnancies? It prevents sperm from reaching the egg and fertilizing it. It prevents the maturation of the follicle and the release of an egg. It prevents a zygote from being implanted into the uterine wall. It prevents the thickening of the walls of the uterus.
Biology
2 answers:
asambeis [7]3 years ago
7 0
It is the first one, prevents sperm from reaching the egg and fertilizing it :) (made fairly obvious in the question where it states they are blocked/severed.) 
Oksana_A [137]3 years ago
4 0
It is the first answer because it blocks the sperm from getting to the eggs.
You might be interested in
The options are: ecosystem, population, food web, or niche
Ghella [55]
Answer:The Answer is Food Web
5 0
3 years ago
An advantage of selective breeding is
Sladkaya [172]
A
learned this in bio last ye
7 0
2 years ago
In many cases, one type of organism puts selection pressure on another, so they evolve together. for example, flowers and their
ser-zykov [4K]
Evolution or its Natural selection
7 0
3 years ago
Which macromolecule short term energy for plants?
posledela
<span>phospholipid is the short term energy name for plants



</span>
7 0
3 years ago
What is the hardness of copper and aluminum
Charra [1.4K]
Aluminum is 15 and copper is 35
7 0
3 years ago
Other questions:
  • Which is the most accurate statement about ferns?
    14·1 answer
  • The atmosphere traps a part of the Sun’s heat that is reflected from Earth’s surface. This effect, called the greenhouse effect,
    7·2 answers
  • Which event signals the Brain to breathe? Gradpoint
    13·2 answers
  • When a bond forms between units of a macromolecule, a water molecule is lost. What is this process called?
    5·1 answer
  • Males of different species of the fruit fly Drosophila that live in the same parts of the Hawaiian Islands have different elabor
    15·1 answer
  • Help???? Can some answer this
    5·1 answer
  • The dandelion is a successful weed. Explain why its adaptations make it a better competitor than many other plants on a school f
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • The liver is ______ (body direction) to the anus. Lateral, medieval, below, or caudal?
    7·1 answer
  • Is the cell wall a bacteria?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!