1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zalisa [80]
3 years ago
6

The students decided that they would investigate some of the abiotic factors. list three water-quality tests that could be condu

cted and explain what information each test provides. include in your answers a description of the impact of each factor on the distribution of aquatic organisms
Biology
1 answer:
Ostrovityanka [42]3 years ago
8 0
<span>One test might be the acid content of the water. Water that does not have a neutral pH might be less conducive to life. Another water quality test might be oxygen levels in the water. Inadequate oxygen levels may also reduce the amount of aquatic life. The presence of pollutants might be a third test. Chemicals that poison the water would negatively impact the number and variety of organisms present.</span>
You might be interested in
Identify one weather variable that determines that whether buffalo recevies rain or snow from a lake effect storm in october
anygoal [31]
The mountains in Buffalo because of the temperature.
4 0
3 years ago
How does the law of conservation of energy relate to the system shown in this model?
uranmaximum [27]

Answer:

The Sun gives off energy to the solar panel which then gives power to the battery, which starts the car.

Explanation:

3 0
3 years ago
Read 2 more answers
The current system used for naming organisms was developed by who?
Alja [10]
Carolus Linnæus

<span> Taxonomy, responsible for many scientific classifications and influences in various field of life sciences or biology.  Evidences that Taxonomy uses to group or categorizes species range from </span><span><span>
1.       </span>"Fossil Records</span> <span><span>
2.       </span>Comparative anatomy</span> <span><span>
3.       </span>Comparative embryology</span> 
4.       Biochemical information <span><span>
5.       </span>Cellular structure</span> <span><span>
6.       </span>Behavior</span>" 
<span>We also suggest that taxonomy has played various roles mainly in many aspects in Zoology, Botany, Anatomy and Physiology –aspects that include animal and human structures and functions. As the biotic community is so diverse it is classified to Biodiversity and the existence of properly assorting by set standard.<span> </span></span>

7 0
3 years ago
A few days ago. i've learned about eclipses.
rewona [7]

Answer:

Thats because moon is very near to earth than sun because moon has orbit around the earth. :)

Brainliest would be appreciated :))

4 0
3 years ago
Read 2 more answers
Explain how critical thinking helps scientists analyze information for accuracy and bias.
Feliz [49]

Answer:

Critical thinking requires scientists to ask questions about information they come across and assess its validity. This facet of critical thinking helps them avoid bias that originates from personal opinion and helps them distinguish information and fact from common belief.

4 0
3 years ago
Other questions:
  • What part of the bacterium allows it to recognize different substances in the outside environment?
    13·1 answer
  • In this figure, which amino acid is specified by the mRNA code CCC?*
    5·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • In a hypotonic solution, the solute concentration is higher<br> outside the cell.<br> True<br> False
    9·1 answer
  • PLEASE HELP THE FIRST PERSON TO ANSWER GETS BRAINLIST
    8·1 answer
  • What would happen if glycolysis stopped happening in a cell?
    15·2 answers
  • Which of the following information could be included in the description of a grasshopper’s niche, but not in a description of it
    7·1 answer
  • Which does not show a relationship between biotic and abiotic parts of an environment?
    15·1 answer
  • Which of the following statements best supports Mendel's Law of Segregation?
    5·1 answer
  • The human body has many types of cells. For example, muscle tissue and skin have different kinds of cells.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!