1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anestetic [448]
3 years ago
8

Which phrase describes carbon-14 dating?

Biology
2 answers:
Svetradugi [14.3K]3 years ago
8 0

Answer: Dates The remains of organisms to determine when they died

Explanation: took the test

Nata [24]3 years ago
5 0

Answer:

<em>"Dates the remains of organisms to determine when they died"</em>

Explanation:

Carbon-14 dating is more commonly known as carbon dating, and uses radiocarbon to determine how old an organism, for example, is.

You might be interested in
The blank process helps fuel your metabolism with oxygen
Natali [406]

Answer:

Cellular Respiration

Explanation:

Metabolism is the sum of chemical reactions taking place in the living organisms. Cellular respiration is one such metabolic process.  Cellular respiration takes place in in the all organisms in which respiratory substrate such as glucose is oxidised completely in presence of oxygen to produce carbon dioxide, water and energy (ATP). Cellular respiration begins in cytoplasm and completes in the mitochondria of the cell.  The energy is used to do work.

The oxidation reaction is given below:

         C₆H₁₂O₆+ 6O₂ → 6CO₂+ 6H₂O + Energy  

6 0
3 years ago
Which planet is smallest Mercury Venus or Earth
Andru [333]

Answer:

The smallest planet is Mercury

Explanation:

5 0
3 years ago
Read 2 more answers
Click an item in the list or group of pictures at the bottom of the problem and, holding the button down, drag it into the corre
Natalka [10]
Not understanding how to click and drag
5 0
3 years ago
Read 2 more answers
Margo is designing an experiment to investigate the rock cycle. She has written the following steps.
Elanso [62]


How does the pressure involved affect the formation of sedimentary rock?
5 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Other questions:
  • The exodus of medical professionals from africa to europe is an example of brain drain as it has the potential to __________.
    13·1 answer
  • the high temperature on a summer day is 88 degrees Fahrenheit &amp; the low temperature is 61 degrees Fahrenheit. what is the di
    7·1 answer
  • Condition of difficult or painful urinating
    6·2 answers
  • What is apical growth​
    13·2 answers
  • 1. Nutrients move from the digestive system into the blood by traveling through ___________, tiny tubes sticking out of the wall
    13·1 answer
  • According to the second law of thermodynamics, what happens to the energy we consume as food?
    12·2 answers
  • How many types of nucleotides are in dna, and how do they differ?
    12·1 answer
  • Hello I need help!!! did I get this right ​
    10·2 answers
  • Select all of the organ systems that are directly part of our immune system? Digestive System Respiratory System Circulatory Sys
    5·1 answer
  • How many molecules are in this chemical formula? 12H2SO4? <br> PLS HELP I WILL MARK BRAINLIST!!!!!!
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!