1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blizzard [7]
3 years ago
6

The brain of an alzheimer's victim displays plaques, which are _____, and tangles, which are _____.

Biology
1 answer:
pav-90 [236]3 years ago
3 0

Scientists can also glimpse the awful effects of Alzheimer's disease when they look at brain tissue beneath the microscope:

Alzheimer's tissue has numerous fewer nerve cells and synapses than a well brain.

<span> <span>Plaques, unusual clusters of protein particle, which are construct up between nerve cells.</span> </span> <span> <span><span>Dead and dying nerve cells contain tangles,</span> which are produce of twisted strands of a further protein.</span> </span>

<span>Scientists are not absolutely sure what causes cell death and tissue deficiency in the Alzheimer's brain, but plaques and tangles are key suspects.</span>

You might be interested in
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
List and describe three stages of development of a fetus after conception.
Roman55 [17]

Conception- This is when the egg and the sperm unite at conception, it is the fertilization and starts at the woman’s fallopian and the fertilized egg , First Trimester - First four weeks of the conception-, Second Trimester- This is 3 months after conception and this is where the baby can be felt kicking and can hear,Third Trimester- 28 weeks after conception and is having breathing movements and the women would be adding some body fat. If I am wrong please let me know

7 0
3 years ago
Read 2 more answers
Which of the following is not a unifying feature of protists
densk [106]
B because they are prokaryotes but cannot be classified as animals, plants, or fungi.
7 0
3 years ago
Which of the following accurately describe nutrient limitation
alex41 [277]
<span>The nutrient in question has an exhausted supply due to which cellular growth is limited. Usually nutrient limitation which limits productivity consist of such essential nutrients which are required by organisms in that environment to survive and grow. 

Hope i helped.</span>
4 0
3 years ago
3. How are chloroplast like solar panels
vichka [17]

Answer:

Chloroplasts work to convert light energy of the Sun into sugars that can be used by cells. It is like a solar panel that changes sunlight energy into electric energy. The entire process is called photosynthesis and it all depends on the little green chlorophyll molecules in each chloroplast.

3 0
2 years ago
Read 2 more answers
Other questions:
  • Bats and birds are unrelated animals, yet they both evolved wings. by acquiring similar traits (i.e., wings) as they adapted to
    8·1 answer
  • Which of the following statements about rural communities is true?
    9·2 answers
  • The complicated molecules that make up living things usually contain carbon. Why is carbon so important in this molescules?
    5·2 answers
  • What are the pros and cons of destroying a virus​
    9·1 answer
  • Soil from flat, poorly drained areas on clay substrate is likely to be have what sort of coloration?
    11·1 answer
  • What are some examples of chemical energy.
    14·2 answers
  • Recent research has demonstrated a correlation between the presence of certain types of Gram-positive bacteria in the human gut
    10·1 answer
  • 5. Norbert is going to be bred with another dragon that has brown scales and blue fire.
    9·1 answer
  • What a water pollution<br> plz hurry
    10·2 answers
  • HELP QUIZ DUE TONIGHT
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!