1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tankabanditka [31]
3 years ago
11

Which of the following statements are true of the cell wall?

Biology
1 answer:
Fittoniya [83]3 years ago
4 0
2,4, and 5 are correct.
You might be interested in
1. Summarize the process of photosynthesis, inputs and outputs of
Fynjy0 [20]

Answer:

explain it in daily life

Explanation:

8 0
3 years ago
Match the level of organization to the correct description.
noname [10]

Answer:

Organism - Individual living thing

Community - All of the different populations that live and interact in an area.

Population - Group of similar organisms.

Ecosystem - Community of organisms and its abioitic environment.

Biosphere - All of the ecosystems.

Hope this helps you

3 0
3 years ago
Marital homogamy tends to occur in the choice of marriage partners because of
ohaa [14]
Had to look for the options and here is my answer. The answer that fits the blank is SPATIAL NEARNESS. When we say spatial nearness, this refers to small distance or closeness and marital homogamy becomes a choice in marriage. <span>Marital homogamy refers to the relationship wherein someone marries another who are of the same sociological status.</span>
3 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Which type of ecosystem needs biodiversity
stiks02 [169]

Answer:

all of them.

Explanation:

biodiversity is good for any ecosystem.

8 0
2 years ago
Other questions:
  • Name three important biochemical need for water
    9·1 answer
  • Which statement correctly describe the difference between meiosis 1 and meosis 2
    7·1 answer
  • C . Single and Double
    15·1 answer
  • Why is mitosis important to your body
    11·2 answers
  • A new viral pathogen has emerged, and you have been asked to develop an ELISA-based detection assay to the intact virions. In or
    13·1 answer
  • Are endocytosis and exocytosis forms of passive or active transport
    15·1 answer
  • Sandra wants to modify the diagram to include chlorophyll. Which would be the most useful strategy? A. Add representations of ch
    12·2 answers
  • PLEASE HELP! Biology Unit Test!
    7·1 answer
  • At a birthday party, a teen decides to inhale some of the helium from a nearby balloon using his mouth. Before the helium gas re
    13·1 answer
  • How would larger substances like proteins get into or out of the cell membrane?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!