1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ksivusya [100]
3 years ago
9

Plant Kingdom to spcises

Biology
2 answers:
horrorfan [7]3 years ago
6 0
Plant Kingdom to species is 24,000 or more species are broken up into three groups/division: Mosses, Liverworts, and Hornworts.
never [62]3 years ago
6 0
Formerly grouped as a single division, the 24,000 bryophyte species are now grouped into three groups: mosses, liverworts, and hornworts. Also included among the non-vascular plants is Chlorophyta, a kind of fresh-water algae.
You might be interested in
Maritime tropical:<br> What is maritime tropical
nika2105 [10]

Answer:

An air mass that is warm, moist, and usually unstable.

Explanation:

6 0
3 years ago
Which statement best explains how two identical copies of a very large molecule can be made during DNA replication?
Bas_tet [7]

Answer: B. DNA polymerase checks for errors in base pairing as it helps new DNA strands form.

Explanation: DNA polymerase is an enzyme that catalyzes the synthesis of a new DNA strand from a DNA template. This process is known as replication. During replication, DNA polymerase rejects incorrect bases before the phosphodiester bond is formed because it has a 3' -> 5' exonuclease activity that double checks every nucleotide that is added to the growing strand. This check allows the enzyme to remove a newly added mismatched base pair.

6 0
3 years ago
Read 2 more answers
How do the Earth and Moon compare in terms of gravitational force?
Law Incorporation [45]

The Earth and Moon compare in terms of gravitational force as Earth's gravitational force is stronger than the Moon's.

Option A

<u>Explanation:</u>

According to universal law of gravity, the gravitational force is the attractive force between two objects separated by a distance. The magnitude of gravitational force is directly proportional to the product of masses of the objects and inversely proportional to the square of the distances between them.

In this case, the gravitational force acting on us due to Earth will be considered due to the mass of Earth as the mass of Earth is very large compared to our mass.

F=\frac{GM}{R^{2} }

So as the mass of the Earth is greater than the mass of the moon, so the gravitational force of Earth will be stronger than that of Moon.

3 0
3 years ago
Read 2 more answers
What type of data does an an EKG AND ITS importance in understanding the health of the heart.
olganol [36]

Answer:

Each time your heart beats, an electrical signal travels through the heart. An EKG can show if your heart is beating at a normal rate and strength. It also helps show the size and position of your heart's chambers. An abnormal EKG can be a sign of heart disease or damage.

7 0
2 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Other questions:
  • 1) What evidence is there that the human species has been successful so far? Explain.
    11·1 answer
  • Suggest why it is a vital function of pedicellariae to clean the surface of a starfish.
    5·1 answer
  • Compare and contrast aerobic and anaerobic respiration during the redox reaction in glycolysis, which molecule acts as the oxidi
    6·1 answer
  • What is the energy of the hydrogenion gradient created across the inner mitochondrial membrane use to make
    8·1 answer
  • What are the basic building blocks for DNA and RNA?
    5·2 answers
  • What are three tasks that DNA must be able to perform in all organisms? Select three answer choices.
    15·2 answers
  • Why are all of us considered scientists to some extent?
    8·1 answer
  • Plz help
    15·2 answers
  • Which of the following is commonly grown as a green manure crop?
    15·1 answer
  • Question 5
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!