1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blizzard [7]
3 years ago
7

A young man has been diagnosed with hemophilia, and the nurse is planning his discharge teaching. the nurse knows to include wha

t in her discharge teaching?
Biology
1 answer:
Dmitriy789 [7]3 years ago
6 0
<span>The nurse would include ways to prevent bleeding in the first place like avoiding the use of sharp objects, using soft bristled brush for the teeth, avoiding constipation. The nurse would also know to include regular dental care and valuation of joint function to avoid hemophilia arthritis. In case of bleeding one should apply pressure and cold compress and elevate the part to slow down bleeding.</span>
You might be interested in
You want to estimate the number of canvas backs (a type of duck) at the Sacramento Wildlife Refuge. In two days you capture 200
Vsevolod [243]

Answer:

Option A 400 individuals

Explanation:

Using this formula, we can estimate the population size of the canvas backs as this is a capture-recapture method.

N = (MxC) / R

Where N = estimated Number of individuals in the population

M = number of individuals captured and Marked = 200

C = total number Captured the second time (with and without a mark) = 200 and

R= number of individuals Recaptured (those with a mark) = 100

Thus, we have

N = (MxC) / R

= (200 x 200) / 100

= (40,000) / 100

= 400 individuals.

7 0
3 years ago
How is photosynthesis and cellular respiration cyclical ​
kow [346]

Answer:

Explanation:Photosynthesis and aerobic respiration are both part of a cyclic process of biochemical reactions. ... Photosynthesis requires the products of aerobic respiration (carbon dioxide and water), while aerobic respiration requires the products of photosynthesis (glucose and oxygen).

7 0
2 years ago
Which of the following explains why cattle should not be given apples?
Nata [24]

Answer:

"Cows that eat apples can get a bloated stomach and die. But that's not what's happening when your cattle feed on apples fallen on the ground or those that you offer them to diversify their diet. ... So, if you plan to introduce apples into your cows' diet, do so gradually."

So your best choice is option A!

Explanation:

- Eijiro <3

7 0
3 years ago
Read 2 more answers
What is earth’s position in the hierarchy of organizations within the universe?
Nitella [24]

Answer:

Big Bang, the universe is still expanding. Slowly the planets get further away from each other. It's the third planet from the sun, some believed that the earth was in the center of the universe  and now we believe the sun is in the middle.Explanation:

5 0
1 year ago
2. What is the role of the following components in maintaining homeostasis:<br> (b) Control center:
marin [14]

Answer:

To maintain homeostasis, the control center responds to the changes in the stimulus received from the sensor by sending signals to effectors

8 0
1 year ago
Other questions:
  • What is the biggest disadvantage of solar electricity, or at least, why is it not used much more than it currently is?
    12·2 answers
  • It is likely that Earth could lose half of its species in the next ____________ years.
    7·2 answers
  • How does driving in a car that uses gasoline connect to the carbon cycle
    14·1 answer
  • If a plant has 50 chromosomes in the leaf cells and it undergoes vegetative propagation, how many chromosomes will be in the lea
    8·1 answer
  • True false glucose is the most abundant sugar in our bodies.
    8·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • 2. Which take deoxygenated blood back<br> to the heart?<br> O veins<br> O arteries<br> O capillaries
    6·2 answers
  • Why don't we all burn up?<br> Earth science
    9·1 answer
  • The shape and function of a protein molecule is ultimately determined by_______ because this is where protein synthesis begins.
    10·2 answers
  • 3. Which part of the hair contains DNA?<br> a. Cuticle<br> b. Cortex<br> C. Medulla<br> d. Follicle
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!