1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
myrzilka [38]
4 years ago
9

g Indium has two naturally occurring isotopes: 113In with an atomic weight of 112.904 amu, and 115In with an atomic weight of 11

4.904 amu. If the average atomic weight for In is 114.818 amu, calculate the fraction-of-occurrences of 115In isotope. Round off the answer to three significant figures.
Biology
1 answer:
aleksandrvk [35]4 years ago
7 0

Answer:

Fraction-of-occurrences of 115In isotope = 0.957

Explanation:

As we know  weight of 113 In  isotope is equal to the sum of product of fraction-of-occurrences of two constituents isotopes and their atomic weight

^{115}In_w = f_{113}*A_{113} + f_{115}*A_{115} ------(1)

As we know sum of fraction-of-occurrences of two constituents isotopes is equal to one.

f_{113} + f_{115} = 1\\f_{113} = 1- f_{115}---------(2)

Substituting the given values in equation 1, we get

^{115}In_w = f_{113}*A_{113} + f_{115}*A_{115}\\114.818 = (1 - f_{115}) * 112.904 + f_{115} * 114.904\\f_{115} = 0.957

Substituting this value in equation 2 we get -

f_{113} = 1- f_{115}\\f_{113} =  1- 0.957 \\f_{113} = 0.043

You might be interested in
(WILL GIVE BRAINLIEST AND THANKS) As an airplane rises through the atmosphere, machines cause the pressure inside the cabin to d
UNO [17]
These changes are necessary because of gravity 
6 0
3 years ago
Read 2 more answers
This is the type of biome that is found in the water.<br><br>Ex. Oceans; Lakes; Rivers​
svet-max [94.6K]

Answer:

Ocean is the answer. Because it consists in fresh waters and marine

6 0
3 years ago
Which statement best describes homeostasis in a cell?
aleksandr82 [10.1K]

Answer:

I believe the answer is A. The cell is in an equilibrium inside and out when it goes through homeostasis.

Explanation:

6 0
3 years ago
What type of organic chemical are hormones?
Digiron [165]
Amino acids hope i helped have a nice day
7 0
3 years ago
_________is/are an essential part of our nerves, spinal cord, brain, and cell membranes.
grigory [225]
The answer is B Adipose tissue. 

We know that it cant be C or D
And A was wrong.
8 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Discuss two ways that all cells are alike?
    12·1 answer
  • How does silica affect the characteristics of magma?
    15·1 answer
  • Predatory fish that swim in the water column, usually have what kind of coloration?
    5·1 answer
  • In muscle the source of a "phosphate molecule needed to recharge an adp molecule to an atp molecule" is
    10·1 answer
  • This Punnett square shows flower color inheritance in snapdragons. What is the expected ratio of red flowers to pink flowers to
    15·2 answers
  • In order for two objects to have heat transfer through conduction, they must be
    15·1 answer
  • 50 POINTS AND BRAINIEST <br> what happens if public libraries do not obey the federal law?
    6·2 answers
  • Which drug interaction could be avoided when taking diphenhydramine and consuming alcohol?
    12·1 answer
  • True or false? the first vaccine developed was for polio. b. false 2. true or false? louis pasteur developed a rabies vaccine.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!