Ecosystem and pond,
not sure though but good luck !
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The answer is False. The mediastinum is not a cartilage that
forms the lower portion of the breast bone, the mediastinum is the middle part
of the chest cavity, which is located between the lungs of an individual. The
Mediastinum is the area located between the lungs, it contains organs such as
the heart and its large arteries and veins. It may also include the trachea,
the esophagus, the bronchi and last but not the least the lymph nodes.
B.)
Weathered rock
I hope this helped
In terms of processing in the nervous system, the reactio<span>n was faster for the more simple tasks because it required less processing and therefore small amount of neurons had to travel through out nerve system because our frontal lobe had less delay since there was less to think about.</span>
