1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inn [45]
3 years ago
5

A system in which both energy and matter are exchanged with the surroundings is known as a(n) _________________.

Biology
2 answers:
sertanlavr [38]3 years ago
4 0
Open System - a system in which both energy and matter are exchanged with the surroundings
Alecsey [184]3 years ago
4 0

Answer:

B. Open system

Explanation:

An open system is the one that exchanges both energy and matter with its surroundings. The term implies that the open system exchange energy with its surroundings according to the temperature gradient and there is an exchange of matter as well.  

For example, all living beings are open systems. Human is also an example of an open system. We derive energy from the food that we get from our surroundings. We can also take the energy of solar radiations. So, humans are capable of exchange of energy and matter with its surroundings.

You might be interested in
Stem cells are cells that stay the same and never differentiate into different types of cells.
mamaluj [8]
The answer is false because it is
6 0
3 years ago
Read 2 more answers
You there......................please help me answer this question right now :D 20 Points!!
Nimfa-mama [501]

Substitution Mutation - A mutation that exchanges one base for another. For this example substitute A with G which will result in this sequence:

GCTGGTCGGCTG

Deletion Mutation - A mutation in which a section of the DNA is cut or lost.

GCTAATCGGCTA -> GCTCGGTA; section AAT was deleted

Insertion Mutation - Extra base pairs are inserted into a new place within the DNA

GCTAATGCGCGGCTA - GCG was added after AAT

Hope this helps!

3 0
3 years ago
Endocytosis: uses simple diffusion move material across the plasma membrane. is the process of taking materials into the cell. d
marta [7]

Answer:

B.) is the process of taking materials into the cell

Explanation:

A.) is incorrect because endocytosis move things into the cell by collapsing the cellular membrane around the substance and then budding off.

C.) is incorrect because the material is not always directed to the endoplasmic reticulum. Most the the material is directed to the lysosomes.

D.) is incorrect because phagosomes are created during phagocytosis, a special type of endocytosis.

4 0
2 years ago
5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
dusya [7]

Answer for this question will be

3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand  will be 5'UACGGGCCCACAGCAUAACU 3'

8 0
3 years ago
which is a structure that contains the cell heredity information controls the cell growth and reproduction​
kvv77 [185]

Answer: I'm pretty sure that is the nucleus and i am so sorry if i am wrong

Explanation:

8 0
3 years ago
Other questions:
  • The short-term controls of blood pressure, mediated by the nervous system and bloodborne chemicals, primarily operate via all bu
    13·1 answer
  • What animal has long eyelashes and hair lined ears that block blowing sand can close its nostrils to keep sand out?
    12·1 answer
  • glucose, dha, folic acid or sucrose- Which of the food ingredient is important for brain development?
    11·2 answers
  • Which microscope is used to observe a specimen that emits light when illuminated with an ultraviolet light?
    6·1 answer
  • Please help me with this
    6·2 answers
  • Which of the following are not required for clot formation?
    13·1 answer
  • I need help FAST!! U have too match the letters with the #.!
    9·1 answer
  • The food prevented from leaving the stomach by a _________​
    14·2 answers
  • Complete the sentence. Lobbyists of ______________ use access to political leaders and other federal members to attempt to influ
    15·1 answer
  • Factors derived from factor analysis may themselves be interrelated. When such factors are themselves factor analyzed, the resul
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!