1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hunter-Best [27]
2 years ago
15

Why are embryonic stem cells useful for medicine

Biology
2 answers:
MrRissso [65]2 years ago
8 0
Well to use to make more specialized tissue that has been lost from disease or injury.
Blababa [14]2 years ago
5 0

In apex it's "that are pluripotent"

You might be interested in
Janelle made a hypothesis about the uneven temperatures inside her house during winter. she believes that 50% of the heating duc
andrey2020 [161]
If Janelle wants to prove her hypothesis on the uneven temperatures inside her house during winter, the next logical step would be to run an experiment. 
8 0
2 years ago
Read 2 more answers
Identify one way in which the process of growth of a human embryo is similar to the process of reproduction in a single called o
iragen [17]

Answer:

The correct answer would be mitosis and binary fission.

The human embryo grows through the process of mitotic divisions through a parent cell divides into two equal sized daughter cells each of which contains identical genetic material.

Similarly, single-celled organisms reproduce asexually through the process of binary fission during a parent cell divides into two equal sized daughter cells each of which contains identical genetic material. Each daughter cell grows and matures to become an independent adult.

6 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
Which best describes a bacterium?
lara [203]

This question isn't really finished, but bacterium are unicellular prokaryote.

I hope this helps?.. :S

4 0
2 years ago
During which step of mitosis does a new membrane form around each of the two groups of chromosomes? **just the answer please**
dmitriy555 [2]
The answer is telophase
8 0
2 years ago
Other questions:
  • Which statement regarding the ecosystem shown in the diagram below is correct
    10·1 answer
  • Student Worksheet: Human Life Stages
    13·2 answers
  • Comparing sequences between genes and between species allows evaluation of the rates of change. Which of the following have been
    7·2 answers
  • Helpppp!!
    14·1 answer
  • What is the function of the nucleolus?<br> *Subject was not below, but the subject is science.
    7·1 answer
  • True or False? No organism can maintain homeostasis by itself
    6·1 answer
  • An interaction in which drugs combine in the body to produce extremely uncomfortable reactions is called antagonism. synergism.
    9·1 answer
  • What should I do when my family makes fun of me because i have Entomophobia (fear of any insect) everytime i go outside and see
    8·2 answers
  • If oxygen is used to carry out cell respiration, the process is called aerobic.
    11·1 answer
  • During which stage of mitosis do the chromosomes line up along the middle of dividing cell
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!