1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katrin2010 [14]
3 years ago
13

Mike and Beatrice purchase a house for $200,000. If the equation V = 200,000(1.03)x represents the value of the house after x ye

ars, how many years will it take the house to be worth approximately $225,000?
Mathematics
2 answers:
Kitty [74]3 years ago
7 0

Answer:4 years


Step-by-step explanation:


notsponge [240]3 years ago
6 0
X=((log(225000/200000)/log(1.03))
X=log(225,000÷200,000)÷log(1.03)
X=3.98 years
You might be interested in
If you measure 5/6 meter,how many twelfths have you measured
MrMuchimi
You've measured 10/12ths
3 0
3 years ago
Factoring polynomials. Please help I suck at factoring (especially polynomials) Ill give brainiest too
BlackZzzverrR [31]

the two numbers are -36 and -2.. thier product is 72 but thier sum is -38..

this one took me time lol

6 0
2 years ago
Find the coordinates of the midpoint of (-8,-3) and (2,-5)
Jet001 [13]
The midpoint is just the average of the coordinates of the endpoints.

((-8+2)/2, (-3-5)/2)

(-6/2, -8/2)

(-3,-4)
8 0
3 years ago
WILL GIVE BRAINLIEST!!!!!!!!!!!!! the answer for question one was x=30
VMariaS [17]

Answer:1

1. x = 30

2. ∠ABC = 120°, ∠BCD = 90°, ∠CDA = 60°, ∠DAB = 90°

Step-by-step explanation:

It's important to note here that the measure of all interior angles in a quadrilateral will add up to 360°

We know this using the formula(n-2)\cdot 180, a 4 sided figures angles will add up to

(4-2)\cdot 180\\\\2\cdot 180\\\\360

This means that all of the angles (4x, 3x, 2x, 3x) will add up to 360.

4x + 3x + 2x + 3x = 360

Combine like terms:

12x = 360

Divide both sides by 12:

x = 30

We know now substitute x for 30 in for all of the side lengths.

∠ABC = 4x = 4\cdot 30 = 120°

∠BCD = 3x = 3\cdot 30 = 90°

∠CDA = 2x = 2\cdot 30 = 60°

∠DAB = 3x = 3\cdot 30 = 90°

Hope this helped!

4 0
3 years ago
Read 2 more answers
Find the time required for an investment of 5000 dollars to grow to 8300 dollars at an interest rate of 7.5
Nutka1998 [239]

Answer:

1.60 (rounded)

Step-by-step explanation:

I haven't done this in a while but you'd use the compound interest formula a=p(1+r)^n where a=8300 p=5000 r=0.075 and solve for n

4 0
2 years ago
Other questions:
  • Burj al Arab hotel another one of the world's tallest buildings Built in 1973, it is 1,136 feet high and has 80 stories. If each
    5·1 answer
  • Which statement is true about a translation? 1. A translation takes a line to a parallel line or itself. 2. A translation takes
    11·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Evaluate the expression 3a - 2ab if a= 4 and b= 6<br><br><br> please explain, thank you !
    14·2 answers
  • A. NOT CONGRUENT<br><br> b. AAS<br><br> c. SSS<br><br> d. ASA<br><br> e. SAS
    12·1 answer
  • Which expression is equivalent to ( x<br> 27<br> ვ<br> ?<br> o x*(V)<br> o x?? (2)<br> *24 (/
    6·1 answer
  • Find the value of x (URGENT/GIVING BRAINLIEST)
    6·1 answer
  • If g(x) = 1 - 3/4x, find g(0)
    13·1 answer
  • Notah lives in Minnesota. He records the lowest temperature each day for one week. What is the mean of the temperatures? -7.3°F,
    15·2 answers
  • The mean temperature for the first 7 days in January was 6 °C.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!