1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adell [148]
3 years ago
8

Imagine a world in which all the elements

Biology
1 answer:
STatiana [176]3 years ago
3 0

 If the element fail to form bonds between them you and I wouldn't exist all the living forms are made up of complex organic molecules which are synthesized from inorganic sources starting from the fabric we wear to the food we eat everything is made up of complex organic molecules life wouldn't have originated on earth if elements wouldn't have formed any chemical bonds with each other.

You might be interested in
PlsHelp!!!!!!!!!!!!!!!!!!!!!!!!!
Troyanec [42]

Answer:

#male gametes are formed

#generative nucleus divides

#fertilization takes place

#pollen tube grows

# zygote is formed

#embryo is formed

6 0
3 years ago
Read 2 more answers
What factor defines all groups in the Köppen system, with the exception of dry climates? evaporation precipitation air pressure
Liula [17]

Answer:

temperature

Explanation:

I choose temperature because it tells how hot,cold,dry and warm somethings are meanwhile evaporation is when water changes from liquid to gas,so that means water gets hot.

Precipitation is when water released from the cloud to form rain,freezing rain,sleet,snow,or hail.Which means thing get cold.

Air pressure also affect evaporation, which means that water will not be able to come up of the surface of a body of water.So that means the the pressure will be pushing down on the surface of the water.

7 0
3 years ago
Enzymes increase the rate of a reaction by ________. enzymes increase the rate of a reaction by ________. changing the ph of the
lisov135 [29]
The third i think.....
6 0
3 years ago
Bill wants to determine his blood type, so he takes a few drops of blood from a puncture wound in his finger and mixes it with v
natita [175]

Answer:

The correct answer is d Bill"s plasma contain B antibodies

Explanation:

As Bill"s plasma contain B antibodies that"s why his blood cells do not aggutinate when mixed with anti B serum.

6 0
3 years ago
1. Which of the following correctly pairs a structure in a eukaryotic cell with its description?
Veseljchak [2.6K]

Answer:

b

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • Wolf-Hirschhorn syndrome affects the faces of the individuals who are suffering from it. The short arm of their chromosome 4 is
    14·1 answer
  • A divide as it relates to Earth science is the
    14·1 answer
  • Woodlice are more active as they move from a dry area to humid area. Which innate behavior are they displaying here?
    15·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which activity is most likely a result of a sudden, unexpected change in the<br> environment?
    11·1 answer
  • I’m so desperate pls help<br> Which letter in the diagram above represents a complete nucleotide?
    14·1 answer
  • PLEASE HELP! IT IS DUE IN 5 MINS
    8·1 answer
  • What is inside a seed?
    15·2 answers
  • Which of the following best describes temperature?
    12·1 answer
  • What’s the color of the grass
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!