1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lelechka [254]
3 years ago
8

Which plant provides its fruits and flowers as food .what are they rich in?

Biology
2 answers:
V125BC [204]3 years ago
6 0
A peach, which is rich in Vitamin E.
Contact [7]3 years ago
3 0
Peach and it is rich with vitamin E
You might be interested in
Which area on the map has been identified by scientistas
Zarrin [17]

Answer:

jssuusisiisieiwjjwjejejejejjd

5 0
3 years ago
A population of a tree snail species has different patterns in their shells. These slight
Alja [10]

Variations can be genetic or environmental, the traits are passed from one generation to other generation of snail is from from both parents to offspring and through the environment.

The correct answer is C.

Explanation:

Genetic variation in an organism is passed to the offspring by its parents.

environmental variation is the the result of different environment with which individual adapt.

Natural selection is a process in which a suitable trait which is well adapted to the environment is passed on tho future generations.

Genetic variation is the change in DNA or gene of the individual trait. The tree snails having different pattern in their shells is due to the habitat they are living in.

The snails which have well adapted to the environment are able to reproduce and pass on the traits to their progeny. The variation is due to the traits passed from parents through the environment also.

5 0
4 years ago
A scientific ___________ is a proposed explanation for a narrow set of phenomena.
densk [106]
My answer is hypothesis
7 0
3 years ago
Read 2 more answers
Which mechanism of genetic variation results from the exchange of gene segments between non-sister chromatids? Select one of the
Marysya12 [62]
A) Crossing over is the mechanism of genetic variation that results from the exchange of gene segments between non-sister chomatids.
6 0
4 years ago
Read 2 more answers
What types of cells do divide often
Eddi Din [679]

The answer is skin cells. Other cells, like nerve and brain cells, divide much less often.

7 0
3 years ago
Other questions:
  • Identify 3 reasons organisms need energy..
    12·1 answer
  • What cell structure is composed of a stack of slightly curved saccules that are important in packaging and secretion?
    13·1 answer
  • Which sphere is most directly studied <br><br> by an astronomer
    14·1 answer
  • During which part of meiosis (meiosis I or meiosis II) do the two alleles of a gene separate? During which phase does the separa
    8·1 answer
  • The action by which a plant grows toward sunlight is called _____.
    6·2 answers
  • 5. What types of genes change very slowly?
    6·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • 7. Explain why there is a difference in the amount of oxygen taken in at rest and during the vigorous activity, (2​
    9·2 answers
  • Answer the question below i give brainliest if you answer
    6·2 answers
  • Freshwater wetlands can be found _______. A. Along freshwater lakes b. In the lower regions of rivers c. In a range of climates
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!