1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anon25 [30]
3 years ago
15

What are 7 non-examples of non-living things?

Biology
1 answer:
Anuta_ua [19.1K]3 years ago
7 0
<h2>Answer: sunlight, temperature, water, air, wind, rocks, soil</h2>
You might be interested in
What occurs in photosystem 1? a. Glucose is made b.water is split into oxygen and hydrogen c.ATP is produced and NADPH is produc
brilliants [131]

Answer:

A

Explanation:

3 0
3 years ago
Which protist exhibits both animal-like and plant-like characteristics?
mote1985 [20]
Euglena. It does photosynthesis like a plant, and moves around and eats like an animal.
7 0
3 years ago
Nutrition affects development of the physical brain therefore: nutrition can not contribute to IQ scores nutrition is not relate
melomori [17]

Answer:

//

Explanation:

Nutrition is related to intelligence?

6 0
2 years ago
A trait that is masked by a dominant trait is called _____.
melisa1 [442]

Recessive traits thats what they are called


8 0
2 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
2 years ago
Other questions:
  • Using the crisscross method, what is the chemical formula for the ionic compound created when potassium (K) combines with Sulfur
    10·1 answer
  • Terry erwin and janice scott used an insecticide to knock down insects from the canopy of several trees. why did they do this?
    12·1 answer
  • What is the name for the compound with the formula Ba0
    15·1 answer
  • Is it ok to eat the black part of a banana reddit?
    8·2 answers
  • Under the 1980 Low-Level Radioactive Waste Policy Act, each state must take responsibility for its non-defense related, low-leve
    6·1 answer
  • Even before the structure of DNA was elucidated, experimental evidence indicated that the hereditary material had to have three
    8·1 answer
  • Identify the muscle marked by the star (*): *<br> 27 points
    13·1 answer
  • Which process and type ??
    11·1 answer
  • 15. A mountain divides a population. After many years the organisms show genetic differences from the original
    8·1 answer
  • the deformity rate in baby birds from nests in pesticide-sprayed fields is compared to the deformity rate in birds from nests in
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!