1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inessss [21]
4 years ago
5

______ properties can be observed only when the substance in a sample of matter are changing into different substances

Biology
2 answers:
blsea [12.9K]4 years ago
8 0
Chemical properties can be observed only when the substance in a sample of matter are changing into different substances.
sattari [20]4 years ago
7 0

Answer: Chemical

Explanation:

Chemical properties of a substance can be observed only when the substances are changing its properties.

The change is irreversible so it needs to be at the time it is taking place else it would not be visible to the people.

The change in color of chemical substances can be observed during the time of chemical reaction.

You might be interested in
The amount of energy that is transferred at each level of the food chain is about _____. 1% 10% 50% 90%
Sloan [31]
The amount of energy that is transferred at each level of the food chain is about 10%. This is called the 10% rule (10 per cent rule).
7 0
4 years ago
Read 2 more answers
Which two macromolecules contain nitrogen?
AlexFokin [52]

There are four classes of macromolecules (polysaccharides or carbohydrates, triglycerides or lipids, polypeptides or proteins, and nucleic acids such as DNA & RNA). Carbohydrates and lipids are made of only carbon, hydrogen, and oxygen (CHO). Proteins are made of carbon, hydrogen, oxygen, and nitrogen (CHON).

HOPE THIS HELPED!!! XD

5 0
3 years ago
Read 2 more answers
What category of classification is used for the first term in a scientific name?
Colt1911 [192]
Genus. Becasue it goes genus then species ex:homo sapian
3 0
3 years ago
Match each type of restriction with one of its purposes
levacccp [35]
Protect certain producers to price control , protect domestic producers to trade restrictionas, ensure a basic living wage to labor laws.

This restrictions can help by allowing a balance between the producers and the price of the products. This protects the local producers from the exported products and services. This can also help in regulating the rightful wage a worker must have.
6 0
3 years ago
As a collision is about to happen if you had enough time to choose between hitting a large haystack or a telephone pole which on
marta [7]
If you had the choice of which to hit ,obviously it would be the haystack. The haystack would have more give and would not have rapid deceleration like hitting a hard object like a telephone pole.
6 0
3 years ago
Other questions:
  • After the process of blank occurs each daughter cell receives an extra copy of parent cells DNA
    10·1 answer
  • In Tinker v. Des Moines, why did the Supreme Court rule in favor of the students who wore armbands?
    6·2 answers
  • Many nutrients are absorbed in the blood stream from the small intestine. the first organ that gets this nutrient blood is
    12·1 answer
  • Looking at a karaotype of a human, explain how to identify if the chromosomes belong to a male or a female.
    10·1 answer
  • imagine that the farmlands in illinois and new york have been abandoned. After 300 years how will the vegatation on these lands
    9·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What type of communication coordinates actions between neighboring cell
    15·2 answers
  • Which of the following is another name for a producer?
    14·1 answer
  • Which components make up the cardiovascular system?
    9·2 answers
  • Reactant - product
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!